Pavir.Ga00891 (Panicum virgatum)
Sox

TF Information

Pfam ID Interpro ID Gene ID CIS-BP ID Sequence source
PF00505 (HMG_box) IPR000910 Pavir.Ga00891 T334671_2.00 JGI:Phytozome (2018-Apr-12)

Directly determined binding motifs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
No direct experiments

Motifs from related TFs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
CRC
M07266_2.00
Arabidopsis thaliana
TWATCATW

WATGATWA
Dap-seq
OMalley et al.(2016)
CRC_col_a
0.689 0.727
CRC
M07267_2.00
Arabidopsis thaliana
GGTTAGTGTTTTGGAGTCGAATATGACTTG

CAAGTCATATTCGACTCCAAAACACTAACC
Dap-seq
OMalley et al.(2016)
CRC_colamp_a
0.689 0.727
YAB1
M00890_2.00
Arabidopsis thaliana
AATAATWA

TWATTATT
PBM
Franco-Zorrilla et al.(2014)
YAB1
0.674 0.932
YAB5
M02486_2.00
Arabidopsis thaliana
NNNNHRN

NYDNNNN
PBM
Weirauch et al.(2014)
pTH7575
0.644 0.886
YAB5
M00889_2.00
Arabidopsis thaliana
NATRATTADNNN

NNNHTAATYATN
PBM
Franco-Zorrilla et al.(2014)
YAB5
0.644 0.886
INO
M02485_2.00
Arabidopsis thaliana
NHNNNYRNNN

NNNYRNNNDN
PBM
Weirauch et al.(2014)
pTH7516
0.567 0.727
For this family, TFs with SR scores > 0.415 will likely have a similar motif

DNA Binding Domains

Protein ID Domain From To Sequence
Pavir.Ga00891.1.p Sox 183 226
Pavir.Ga00891.2.p Sox 182 225

Links

Other Sox family TFs
Other Panicum virgatum TFs

523 Related TFs

Name Species Gene ID Motif Evidence SR
Score
Action
sma-4 Caenorhabditis elegans WBGene00004858 D 0.000
SMAD4 Homo sapiens ENSG00000141646 D 0.000
TELCIR_11814 Teladorsagia circumcincta TELCIR_11814 I 0.000
NBR_0001377901 Nippostrongylus brasiliensis NBR_0001377901 I 0.000
nAv.1.0.1.g08553 Acanthocheilonema viteae nAv.1.0.1.g08553 I 0.000
maker-nMf.1.1.scaf05118-snap-gene-0.7 Meloidogyne floridensis maker-nMf.1.1.scaf05118-snap-gene-0.7 I 0.000
L893_g15056 Steinernema glaseri L893_g15056 I 0.000
L892_g4495 Steinernema scapterisci L892_g4495 I 0.000
L889_g22387 Steinernema feltiae L889_g22387 I 0.000
L596_g26024 Steinernema carpocapsae L596_g26024 I 0.000
HPBE_0002536701 Heligmosomoides bakeri HPBE_0002536701 I 0.000
HCOI02014300 Haemonchus contortus HCOI02014300 I 0.000
HCOI01928500 Haemonchus contortus HCOI01928500 I 0.000
Hba_14016 Heterorhabditis bacteriophora Hba_14016 I 0.000
GPUH_0001329001 Gongylonema pulchrum GPUH_0001329001 I 0.000
nDi.2.2.2.g01429 Dirofilaria immitis nDi.2.2.2.g01429 I 0.000
nDi.2.2.2.g06233 Dirofilaria immitis nDi.2.2.2.g06233 I 0.000
TELCIR_06960 Teladorsagia circumcincta TELCIR_06960 I 0.000
TCLT_0000412001 Thelazia callipaeda TCLT_0000412001 I 0.000
SVE_0858500 Strongyloides venezuelensis SVE_0858500 I 0.000
SSTP_0000769000 Strongyloides stercoralis SSTP_0000769000 I 0.000
SPAL_0001099400 Strongyloides papillosus SPAL_0001099400 I 0.000
scaffold21-EXSNAP2012.60 Pristionchus exspectatus scaffold21-EXSNAP2012.60 I 0.000
RSKR_0000114900 Rhabditophanes kr3021 RSKR_0000114900 I 0.000
PTRK_0001020700 Parastrongyloides trichosuri PTRK_0001020700 I 0.000
OFLC_0000505301 Onchocerca flexuosa OFLC_0000505301 I 0.000
nOo.2.0.1.g06266 Onchocerca ochengi nOo.2.0.1.g06266 I 0.000
nOo.2.0.1.g00181 Onchocerca ochengi nOo.2.0.1.g00181 I 0.000
nLs.2.1.2.g01829 Litomosoides sigmodontis nLs.2.1.2.g01829 I 0.000
GPUH_0001294301 Gongylonema pulchrum GPUH_0001294301 I 0.000
GPLIN_000764400 Globodera pallida GPLIN_000764400 I 0.000
EVEC_0000562301 Enterobius vermicularis EVEC_0000562301 I 0.000
WBGene00245700 Onchocerca volvulus WBGene00245700 I 0.000
WBGene00241622 Onchocerca volvulus WBGene00241622 I 0.000
Ppa-sma-4 Pristionchus pacificus PPA17857 I 0.000
LOAG_05337 Loa loa LOAG_05337 I 0.000
CRE04707 Caenorhabditis remanei CRE04707 I 0.000
CJA09693 Caenorhabditis japonica CJA09693 I 0.000
CBN31444 Caenorhabditis brenneri CBN31444 I 0.000
CBG09090 Caenorhabditis briggsae CBG09090 I 0.000
Bm5359 Brugia malayi Bm5359 I 0.000
Bm3575 Brugia malayi Bm3575 I 0.000
Bm11291 Brugia malayi Bm11291 I 0.000
WUBG_08631 Wuchereria bancrofti WUBG_08631 I 0.000
Minc06316 Meloidogyne incognita Minc06316 I 0.000
Minc10272 Meloidogyne incognita Minc10272 I 0.000
DICVIV_05422 Dictyocaulus viviparus DICVIV_05422 I 0.000
CGOC_0000897101 Cylicostephanus goldi CGOC_0000897101 I 0.000
BXY_1538500 Bursaphelenchus xylophilus BXY_1538500 I 0.000
BTMF_0000952301 Brugia timori BTMF_0000952301 I 0.000
BTMF_0000404601 Brugia timori BTMF_0000404601 I 0.000
ASU_13433 Ascaris suum ASU_13433 I 0.000
ASU_10605 Ascaris suum ASU_10605 I 0.000
ASIM_0001604001 Anisakis simplex ASIM_0001604001 I 0.000
ASIM_0001219601 Anisakis simplex ASIM_0001219601 I 0.000
ANCDUO_13021 Ancylostoma duodenale ANCDUO_13021 I 0.000
ANCCAN_26651 Ancylostoma caninum ANCCAN_26651 I 0.000
ALUE_0001111401 Ascaris lumbricoides ALUE_0001111401 I 0.000
WUBG_02880 Wuchereria bancrofti WUBG_02880 I 0.000