Pavir.Ga00891 (Panicum virgatum)
Sox

TF Information

Pfam ID Interpro ID Gene ID CIS-BP ID Sequence source
PF00505 (HMG_box) IPR000910 Pavir.Ga00891 T334671_2.00 JGI:Phytozome (2018-Apr-12)

Directly determined binding motifs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
No direct experiments

Motifs from related TFs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
CRC
M07266_2.00
Arabidopsis thaliana
TWATCATW

WATGATWA
Dap-seq
OMalley et al.(2016)
CRC_col_a
0.689 0.727
CRC
M07267_2.00
Arabidopsis thaliana
GGTTAGTGTTTTGGAGTCGAATATGACTTG

CAAGTCATATTCGACTCCAAAACACTAACC
Dap-seq
OMalley et al.(2016)
CRC_colamp_a
0.689 0.727
YAB1
M00890_2.00
Arabidopsis thaliana
AATAATWA

TWATTATT
PBM
Franco-Zorrilla et al.(2014)
YAB1
0.674 0.932
YAB5
M02486_2.00
Arabidopsis thaliana
NNNNHRN

NYDNNNN
PBM
Weirauch et al.(2014)
pTH7575
0.644 0.886
YAB5
M00889_2.00
Arabidopsis thaliana
NATRATTADNNN

NNNHTAATYATN
PBM
Franco-Zorrilla et al.(2014)
YAB5
0.644 0.886
INO
M02485_2.00
Arabidopsis thaliana
NHNNNYRNNN

NNNYRNNNDN
PBM
Weirauch et al.(2014)
pTH7516
0.567 0.727
For this family, TFs with SR scores > 0.415 will likely have a similar motif

DNA Binding Domains

Protein ID Domain From To Sequence
Pavir.Ga00891.1.p Sox 183 226
Pavir.Ga00891.2.p Sox 182 225

Links

Other Sox family TFs
Other Panicum virgatum TFs

523 Related TFs

Name Species Gene ID Motif Evidence SR
Score
Action
AAEL002763 Aedes aegypti AAEL002763 N 0.000
AAEL004799 Aedes aegypti AAEL004799 N 0.000
AAEL015495 Aedes aegypti AAEL015495 N 0.000
AATE004258 Anopheles atroparvus AATE004258 N 0.000
AATE004381 Anopheles atroparvus AATE004381 N 0.000
ACEP11966 Atta cephalotes ACEP11966 N 0.000
ACOM042270 Anopheles coluzzii ACOM042270 N 0.000
ACUA022483 Anopheles culicifacies ACUA022483 N 0.000
ACUA027622 Anopheles culicifacies ACUA027622 N 0.000
ACYPI006067 Acyrthosiphon pisum ACYPI006067 N 0.000
AFAF002247 Anopheles farauti AFAF002247 N 0.000
AFAF016561 Anopheles farauti AFAF016561 N 0.000
AFUN003754 Anopheles funestus AFUN003754 N 0.000
AFUN003758 Anopheles funestus AFUN003758 N 0.000
AGAP002082 Anopheles gambiae AGAP002082 N 0.000
AGAP002083 Anopheles gambiae AGAP002083 I 0.000
AMAM007515 Anopheles maculatus AMAM007515 N 0.000
AMAM023802 Anopheles maculatus AMAM023802 N 0.000
AMEC016152 Anopheles melas AMEC016152 N 0.000
AMEC018985 Anopheles melas AMEC018985 N 0.000
AMEC019868 Anopheles melas AMEC019868 N 0.000
AMEM000733 Anopheles merus AMEM000733 N 0.000
AMEM001627 Anopheles merus AMEM001627 N 0.000
ASIS002621 Anopheles sinensis ASIS002621 N 0.000
ASIS011627 Anopheles sinensis ASIS011627 N 0.000
Cflo_10706--XP_392003.1_APIME Camponotus floridanus Cflo_10706--XP_392003.1_APIME N 0.000
CLEC008150 Cimex lectularius CLEC008150 N 0.000
CPIJ013161 Culex quinquefasciatus CPIJ013161 N 0.000
CPIJ020207 Culex quinquefasciatus CPIJ020207 N 0.000
CpipJ_CPIJ013161 Culex pipiens CpipJ_CPIJ013161 N 0.000
CpipJ_CPIJ020207 Culex pipiens CpipJ_CPIJ020207 N 0.000
GA26220 Drosophila pseudoobscura FBgn0247595 I 0.000
GB54118 Apis mellifera GB54118 N 0.000
GF17309 Drosophila ananassae FBgn0094327 N 0.000
GH19280 Drosophila grimshawi FBgn0126746 N 0.000
GI23490 Drosophila mojavensis FBgn0146216 N 0.000
GJ10241 Drosophila virilis FBgn0197528 N 0.000
GK11085 Drosophila willistoni FBgn0213096 N 0.000
GM10491 Drosophila sechellia FBgn0165439 N 0.000
L798_13150 Zootermopsis nevadensis L798_13150 N 0.000
LLOJ002296 Lutzomyia longipalpis LLOJ002296 N 0.000
MDOA008356 Musca domestica MDOA008356 N 0.000
NV18441 Nasonia vitripennis NV18441 N 0.000
rn Drosophila melanogaster FBgn0267337 D 0.000
RPRC000740 Rhodnius prolixus RPRC000740 N 0.000
SMAR014468 Strigamia maritima SMAR014468 N 0.000
TC016018 Tribolium castaneum TC016018 N 0.000
YQE_06536 Dendroctonus ponderosae YQE_06536 N 0.000