Pavir.Ib00755 (Panicum virgatum)
Sox

TF Information

Pfam ID Interpro ID Gene ID CIS-BP ID Sequence source
PF00505 (HMG_box) IPR000910 Pavir.Ib00755 T334677_2.00 JGI:Phytozome (2018-Apr-12)

Directly determined binding motifs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
No direct experiments

Motifs from related TFs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
CRC
M07266_2.00
Arabidopsis thaliana
TWATCATW

WATGATWA
Dap-seq
OMalley et al.(2016)
CRC_col_a
0.673 0.800
CRC
M07267_2.00
Arabidopsis thaliana
GGTTAGTGTTTTGGAGTCGAATATGACTTG

CAAGTCATATTCGACTCCAAAACACTAACC
Dap-seq
OMalley et al.(2016)
CRC_colamp_a
0.673 0.800
YAB1
M00890_2.00
Arabidopsis thaliana
AATAATWA

TWATTATT
PBM
Franco-Zorrilla et al.(2014)
YAB1
0.657 0.689
YAB5
M02486_2.00
Arabidopsis thaliana
NNNNHRN

NYDNNNN
PBM
Weirauch et al.(2014)
pTH7575
0.627 0.667
YAB5
M00889_2.00
Arabidopsis thaliana
NATRATTADNNN

NNNHTAATYATN
PBM
Franco-Zorrilla et al.(2014)
YAB5
0.627 0.667
INO
M02485_2.00
Arabidopsis thaliana
NHNNNYRNNN

NNNYRNNNDN
PBM
Weirauch et al.(2014)
pTH7516
0.556 0.578
For this family, TFs with SR scores > 0.415 will likely have a similar motif

DNA Binding Domains

Protein ID Domain From To Sequence
Pavir.Ib00755.1.p Sox 107 151

Links

Other Sox family TFs
Other Panicum virgatum TFs

501 Related TFs

Name Species Gene ID Motif Evidence SR
Score
Action
OBART03G08320 Oryza barthii OBART03G08320 I 0.741
ORUFI03G08400 Oryza rufipogon ORUFI03G08400 I 0.741
BGIOSGA012115 Oryza indica BGIOSGA012115 I 0.741
OS03G0215200 Oryza sativa OS03G0215200 I 0.741
OB03G18700 Oryza brachyantha OB03G18700 I 0.741
OGLUM03G08460 Oryza glumaepatula OGLUM03G08460 I 0.741
ORGLA03G0081000 Oryza glaberrima ORGLA03G0081000 I 0.741
OMERI03G08070 Oryza meridionalis OMERI03G08070 I 0.741
ONIVA03G09180 Oryza nivara ONIVA03G09180 I 0.741
Pavir.Ia04690 Panicum virgatum Pavir.Ia04690 I 0.741
OPUNC03G08080 Oryza punctata OPUNC03G08080 I 0.741
GRMZM2G102218 Zea mays GRMZM2G102218 I 0.741
GRMZM2G088309 Zea mays GRMZM2G088309 I 0.741
Si037608m.g Setaria italica Si037608m.g I 0.741
Traes_4BL_34FE2C7F2 Triticum aestivum Traes_4BL_34FE2C7F2 I 0.741
Traes_4AS_BE972A266 Triticum aestivum Traes_4AS_BE972A266 I 0.741
Traes_4AS_BE972A2661 Triticum aestivum Traes_4AS_BE972A2661 I 0.741
PDK_20s1325902g001 Phoenix dactylifera PDK_20s1325902g001 I 0.741
OLONG_009200 Oryza longistaminata OLONG_009200 I 0.741
Sb01g042850 Sorghum bicolor Sb01g042850 I 0.741
LPERR03G07620 Leersia perrieri LPERR03G07620 I 0.741
BRADI1G69900 Brachypodium distachyon BRADI1G69900 I 0.741
TRIUR3_31693 Triticum urartu TRIUR3_31693 I 0.741
GSMUA_Achr4G01430_001 Musa acuminata GSMUA_Achr4G01430_001 I 0.735
GSMUA_Achr6G24550_001 Musa acuminata GSMUA_Achr6G24550_001 I 0.735
GSMUA_Achr5G08930_001 Musa acuminata GSMUA_Achr5G08930_001 I 0.730
GSMUA_Achr1G24490_001 Musa acuminata GSMUA_Achr1G24490_001 I 0.728
GSMUA_Achr1G27150_001 Musa acuminata GSMUA_Achr1G27150_001 I 0.728
GSMUA_Achr1G04480_001 Musa acuminata GSMUA_Achr1G04480_001 I 0.724
GSMUA_Achr8G04340_001 Musa acuminata GSMUA_Achr8G04340_001 I 0.705
GSMUA_Achr3G25290_001 Musa acuminata GSMUA_Achr3G25290_001 I 0.705
GLYMA01G08030 Glycine max GLYMA01G08030 I 0.702
Lus10036811.g Linum usitatissimum Lus10036811.g I 0.702
GLYMA02G13350 Glycine max GLYMA02G13350 I 0.702
Gorai.005G146700 Gossypium raimondii Gorai.005G146700 I 0.702
Cucsa.284430 Cucumis sativus Cucsa.284430 I 0.702
Ca_12379 Cicer arietinum Ca_12379 I 0.702
Ca_18533 Cicer arietinum Ca_18533 I 0.702
CRC Vitis vinifera VIT_01s0011g00140 I 0.702
PRUPE_ppa014900mg Prunus persica PRUPE_ppa014900mg I 0.702
TCM_011484 Theobroma cacao TCM_011484 I 0.702
Cla010397 Citrullus lanatus Cla010397 I 0.702
Pm030598 Prunus mume Pm030598 I 0.702
Ciclev10033770m.g Citrus clementina Ciclev10033770m.g I 0.702
cassava39135.m1 Manihot esculenta cassava39135.m1 I 0.702
cassava10710.m1 Manihot esculenta cassava10710.m1 I 0.702
30174.m009083 Ricinus communis 30174.m009083 I 0.702
evm.TU.contig_30608 Carica papaya evm.TU.contig_30608 I 0.702
Eucgr.B03140 Eucalyptus grandis Eucgr.B03140 I 0.702
SapurV1A.0176s0460 Salix purpurea SapurV1A.0176s0460 I 0.702
PK13838.1 Cannabis sativa PK13838.1 I 0.702
AMTR_s00047p00199030 Amborella trichopoda AMTR_s00047p00199030 I 0.699
PGSC0003DMG400028360 Solanum tuberosum PGSC0003DMG400028360 I 0.698
Solyc05g012050.2 Solanum lycopersicum Solyc05g012050.2 I 0.698
POPTR_0008s09740 Populus trichocarpa POPTR_0008s09740 I 0.696
mgf007067m Mimulus guttatus mgf007067m I 0.696
gene04566-v1.0-hybrid Fragaria vesca gene04566-v1.0-hybrid I 0.696
POPTR_0010s16410 Populus trichocarpa POPTR_0010s16410 I 0.696
SapurV1A.0072s0330 Salix purpurea SapurV1A.0072s0330 I 0.696
MDP0000291729 Malus domestica MDP0000291729 I 0.673
CRC Arabidopsis thaliana AT1G69180 D 0.673
MDP0000124879 Malus domestica MDP0000124879 I 0.673
Bostr.10273s0455 Boechera stricta Bostr.10273s0455 I 0.673
Carubv10021641m.g Capsella rubella Carubv10021641m.g I 0.673
Cagra.0537s0004 Capsella grandiflora Cagra.0537s0004 I 0.673
Bra004364 Brassica rapa Bra004364 I 0.673
Bo6g108630 Brassica oleracea Bo6g108630 I 0.673
Thhalv10019126m.g Eutrema salsugineum Thhalv10019126m.g I 0.673
CRC Arabidopsis lyrata fgenesh2_kg.2__1172__AT1G69180.1 I 0.673
mgf001016m Mimulus guttatus mgf001016m I 0.670
MDP0000171878 Malus domestica MDP0000171878 I 0.668
Bo8g055830 Brassica oleracea Bo8g055830 I 0.663
Bostr.25219s0098 Boechera stricta Bostr.25219s0098 I 0.657
AMTR_s00004p00165390 Amborella trichopoda AMTR_s00004p00165390 I 0.657
Solyc06g073920.2 Solanum lycopersicum Solyc06g073920.2 I 0.657
Bostr.25993s0255 Boechera stricta Bostr.25993s0255 I 0.657
Eucgr.J00587 Eucalyptus grandis Eucgr.J00587 I 0.657
Cagra.0239s0072 Capsella grandiflora Cagra.0239s0072 I 0.657
AMTR_s00078p00029420 Amborella trichopoda AMTR_s00078p00029420 I 0.657
Aquca_009_00652 Aquilegia coerulea Aquca_009_00652 I 0.657
Si030811m.g Setaria italica Si030811m.g I 0.657
OMERI07G02330 Oryza meridionalis OMERI07G02330 I 0.657
mgf009982m Mimulus guttatus mgf009982m I 0.657
Bo6g073320 Brassica oleracea Bo6g073320 I 0.657
mgf019496m Mimulus guttatus mgf019496m I 0.657
OB07G12810 Oryza brachyantha OB07G12810 I 0.657
LPERR07G03250 Leersia perrieri LPERR07G03250 I 0.657
MTR_4g050300 Medicago truncatula MTR_4g050300 I 0.657
TCM_041175 Theobroma cacao TCM_041175 I 0.657
Carubv10024011m.g Capsella rubella Carubv10024011m.g I 0.657
MTR_2g087740 Medicago truncatula MTR_2g087740 I 0.657
Ciclev10029354m.g Citrus clementina Ciclev10029354m.g I 0.657
Solyc11g071810.1 Solanum lycopersicum Solyc11g071810.1 I 0.657
Carubv10010384m.g Capsella rubella Carubv10010384m.g I 0.657
Eucgr.D02474 Eucalyptus grandis Eucgr.D02474 I 0.657
Solyc08g079100.2 Solanum lycopersicum Solyc08g079100.2 I 0.657
Cagra.1261s0010 Capsella grandiflora Cagra.1261s0010 I 0.657
Cagra.4395s0036 Capsella grandiflora Cagra.4395s0036 I 0.657
Carubv10001833m.g Capsella rubella Carubv10001833m.g I 0.657
Bo8g112450 Brassica oleracea Bo8g112450 I 0.657
Bo4g195410 Brassica oleracea Bo4g195410 I 0.657
YAB1 Arabidopsis thaliana AT2G45190 D 0.657
Sb02g003390 Sorghum bicolor Sb02g003390 I 0.657
AFO Arabidopsis lyrata scaffold_403460.1 I 0.657
PGSC0003DMG400005936 Solanum tuberosum PGSC0003DMG400005936 I 0.657
PGSC0003DMG400002988 Solanum tuberosum PGSC0003DMG400002988 I 0.657
PGSC0003DMG400004741 Solanum tuberosum PGSC0003DMG400004741 I 0.657
Cla008752 Citrullus lanatus Cla008752 I 0.657
Thhalv10028925m.g Eutrema salsugineum Thhalv10028925m.g I 0.657
PRUPE_ppa011880m2g Prunus persica PRUPE_ppa011880m2g I 0.657
YAB2 Arabidopsis thaliana AT1G08465 I 0.657
YAB2 Vitis vinifera VIT_06s0009g00880 I 0.657
YAB2 Populus trichocarpa POPTR_0001s22180 I 0.657
AMTR_s00085p00032940 Amborella trichopoda AMTR_s00085p00032940 I 0.657
Ca_07101 Cicer arietinum Ca_07101 I 0.657
Pm001547 Prunus mume Pm001547 I 0.657
YAB3 Arabidopsis thaliana AT4G00180 I 0.657
cassava40986.m1 Manihot esculenta cassava40986.m1 I 0.657
Bo3g037630 Brassica oleracea Bo3g037630 I 0.657
OPUNC07G03670 Oryza punctata OPUNC07G03670 I 0.657
SapurV1A.3336s0010 Salix purpurea SapurV1A.3336s0010 I 0.657
PK06964.1 Cannabis sativa PK06964.1 I 0.657
Cucsa.086660 Cucumis sativus Cucsa.086660 I 0.657
cassava39022.m1 Manihot esculenta cassava39022.m1 I 0.657
Thhalv10001617m.g Eutrema salsugineum Thhalv10001617m.g I 0.657
YAB1 Oryza sativa OS07G0160100 I 0.657
29854.m001136 Ricinus communis 29854.m001136 I 0.657
Bo9g001130 Brassica oleracea Bo9g001130 I 0.657
Thhalv10008858m.g Eutrema salsugineum Thhalv10008858m.g I 0.657
ORUFI07G03450 Oryza rufipogon ORUFI07G03450 I 0.657
Bo5g009010 Brassica oleracea Bo5g009010 I 0.657
Bostr.14547s0027 Boechera stricta Bostr.14547s0027 I 0.657
YAB3 Arabidopsis lyrata fgenesh2_kg.6__3684__AT4G00180.1 I 0.657
SapurV1A.0288s0210 Salix purpurea SapurV1A.0288s0210 I 0.657
GLYMA06G46560 Glycine max GLYMA06G46560 I 0.657
GSMUA_Achr7G01330_001 Musa acuminata GSMUA_Achr7G01330_001 I 0.657
GSMUA_Achr2G12850_001 Musa acuminata GSMUA_Achr2G12850_001 I 0.657
GLYMA12G10210 Glycine max GLYMA12G10210 I 0.657
Gorai.001G127000 Gossypium raimondii Gorai.001G127000 I 0.657
Bra003309 Brassica rapa Bra003309 I 0.657
GRMZM2G106204 Zea mays GRMZM2G106204 I 0.657
MDP0000500810 Malus domestica MDP0000500810 I 0.657
Gorai.006G117800 Gossypium raimondii Gorai.006G117800 I 0.657
MDP0000366291 Malus domestica MDP0000366291 I 0.657
MDP0000331808 Malus domestica MDP0000331808 I 0.657
Bra018624 Brassica rapa Bra018624 I 0.657
Bra000378 Brassica rapa Bra000378 I 0.657
Pavir.Ba03779 Panicum virgatum Pavir.Ba03779 I 0.657
Lus10024603.g Linum usitatissimum Lus10024603.g I 0.657
Lus10032240.g Linum usitatissimum Lus10032240.g I 0.657
evm.TU.supercontig_104.5 Carica papaya evm.TU.supercontig_104.5 I 0.657
Bra040322 Brassica rapa Bra040322 I 0.657
Bra037320 Brassica rapa Bra037320 I 0.657
evm.TU.supercontig_103.34 Carica papaya evm.TU.supercontig_103.34 I 0.657
Gorai.010G062900 Gossypium raimondii Gorai.010G062900 I 0.657
Bra031629 Brassica rapa Bra031629 I 0.657
MDP0000252640 Malus domestica MDP0000252640 I 0.657
GLYMA12G31670 Glycine max GLYMA12G31670 I 0.657
gene03938-v1.0-hybrid Fragaria vesca gene03938-v1.0-hybrid I 0.657
GLYMA13G38750 Glycine max GLYMA13G38750 I 0.657
YAB2 Arabidopsis lyrata fgenesh2_kg.1__861__AT1G08465.1 I 0.657
Bra030728 Brassica rapa Bra030728 I 0.657
orange1.1g029862m.g Citrus sinensis orange1.1g029862m.g I 0.657
orange1.1g046045m.g Citrus sinensis orange1.1g046045m.g I 0.653
F775_28710 Aegilops tauschii F775_28710 I 0.651
Si037789m.g Setaria italica Si037789m.g I 0.651
LPERR03G22960 Leersia perrieri LPERR03G22960 I 0.651
ORUFI12G21410 Oryza rufipogon ORUFI12G21410 I 0.651
YAB2 Oryza sativa OS03G0650000 I 0.651
BGIOSGA013223 Oryza indica BGIOSGA013223 I 0.651
ORUFI03G28820 Oryza rufipogon ORUFI03G28820 I 0.651
GRMZM2G085873 Zea mays GRMZM2G085873 I 0.651
BGIOSGA037817 Oryza indica BGIOSGA037817 I 0.651
Pavir.Ib04136 Panicum virgatum Pavir.Ib04136 I 0.651
Pavir.Ia01130 Panicum virgatum Pavir.Ia01130 I 0.651
ORGLA12G0165000 Oryza glaberrima ORGLA12G0165000 I 0.651
Pavir.Cb00070 Panicum virgatum Pavir.Cb00070 I 0.651
BRADI1G13570 Brachypodium distachyon BRADI1G13570 I 0.651
Pavir.Ca02862 Panicum virgatum Pavir.Ca02862 I 0.651
Traes_5DS_268147383 Triticum aestivum Traes_5DS_268147383 I 0.651
Traes_5DL_0E369E1FC Triticum aestivum Traes_5DL_0E369E1FC I 0.651
Sb01g013270 Sorghum bicolor Sb01g013270 I 0.651
TRIUR3_18590 Triticum urartu TRIUR3_18590 I 0.651
TRIUR3_27402 Triticum urartu TRIUR3_27402 I 0.651
Traes_5BS_A782F7510 Triticum aestivum Traes_5BS_A782F7510 I 0.651
Sb08g022030 Sorghum bicolor Sb08g022030 I 0.651
YAB6 Oryza sativa OS12G0621100 I 0.651
Si023308m.g Setaria italica Si023308m.g I 0.651
Traes_5AL_EB97D69D7 Triticum aestivum Traes_5AL_EB97D69D7 I 0.651
Traes_5AS_31C2540C0 Triticum aestivum Traes_5AS_31C2540C0 I 0.651
Traes_5BL_4DEC298F9 Triticum aestivum Traes_5BL_4DEC298F9 I 0.651
POPTR_0016s06760 Populus trichocarpa POPTR_0016s06760 I 0.651
GRMZM2G074124 Zea mays GRMZM2G074124 I 0.651
SapurV1A.0258s0090 Salix purpurea SapurV1A.0258s0090 I 0.651
OBART03G27740 Oryza barthii OBART03G27740 I 0.651
OMERI12G13460 Oryza meridionalis OMERI12G13460 I 0.651
ONIVA02G03100 Oryza nivara ONIVA02G03100 I 0.651
BRADI4G01300 Brachypodium distachyon BRADI4G01300 I 0.651
OBART12G19190 Oryza barthii OBART12G19190 I 0.651
OGLUM12G20870 Oryza glumaepatula OGLUM12G20870 I 0.651
OGLUM03G28370 Oryza glumaepatula OGLUM03G28370 I 0.651
OPUNC12G17340 Oryza punctata OPUNC12G17340 I 0.651
OLONG_018568 Oryza longistaminata OLONG_018568 I 0.651
OB12G26050 Oryza brachyantha OB12G26050 I 0.651
OPUNC03G25290 Oryza punctata OPUNC03G25290 I 0.651
GRMZM2G116646 Zea mays GRMZM2G116646 I 0.651
MLOC_66260 Hordeum vulgare MLOC_66260 I 0.651
ONIVA03G28660 Oryza nivara ONIVA03G28660 I 0.651
GRMZM2G141955 Zea mays GRMZM2G141955 I 0.651
MLOC_70676 Hordeum vulgare MLOC_70676 I 0.651
OB03G35470 Oryza brachyantha OB03G35470 I 0.651
GSMUA_Achr6G31080_001 Musa acuminata GSMUA_Achr6G31080_001 I 0.647
VIT_08s0032g01110 Vitis vinifera VIT_08s0032g01110 I 0.647
GSMUA_Achr7G07830_001 Musa acuminata GSMUA_Achr7G07830_001 I 0.647
BRADI1G57070 Brachypodium distachyon BRADI1G57070 I 0.646
POPTR_0008s19330 Populus trichocarpa POPTR_0008s19330 I 0.641
GSMUA_AchrUn_randomG19410_001 Musa acuminata GSMUA_AchrUn_randomG19410_001 I 0.640
GSMUA_Achr3G15060_001 Musa acuminata GSMUA_Achr3G15060_001 I 0.636
AMTR_s00096p00054100 Amborella trichopoda AMTR_s00096p00054100 I 0.636
GSMUA_Achr3G30800_001 Musa acuminata GSMUA_Achr3G30800_001 I 0.634
Cucsa.320600 Cucumis sativus Cucsa.320600 I 0.633
INO Vitis vinifera VIT_01s0127g00330 I 0.630
GLYMA18G19720 Glycine max GLYMA18G19720 I 0.630
GSMUA_Achr8G04750_001 Musa acuminata GSMUA_Achr8G04750_001 I 0.630
GLYMA08G39290 Glycine max GLYMA08G39290 I 0.630
GSMUA_Achr8G26600_001 Musa acuminata GSMUA_Achr8G26600_001 I 0.630
Ciclev10021834m.g Citrus clementina Ciclev10021834m.g I 0.628
cassava30083.valid.m1 Manihot esculenta cassava30083.valid.m1 I 0.628
Ciclev10022170m.g Citrus clementina Ciclev10022170m.g I 0.628
Lus10010361.g Linum usitatissimum Lus10010361.g I 0.628
Pavir.Ab02534 Panicum virgatum Pavir.Ab02534 I 0.628
cassava13963.valid.m1 Manihot esculenta cassava13963.valid.m1 I 0.628
Cucsa.302100 Cucumis sativus Cucsa.302100 I 0.628
gene32251-v1.0-hybrid Fragaria vesca gene32251-v1.0-hybrid I 0.628
evm.TU.supercontig_29.121 Carica papaya evm.TU.supercontig_29.121 I 0.628
SapurV1A.0634s0130 Salix purpurea SapurV1A.0634s0130 I 0.628
Pavir.Ib03707 Panicum virgatum Pavir.Ib03707 I 0.628
Traes_2AL_71DE02042 Triticum aestivum Traes_2AL_71DE02042 I 0.628
Traes_1DL_C5AF9D06A Triticum aestivum Traes_1DL_C5AF9D06A I 0.628
LjSGA_107961.1 Lotus japonicus LjSGA_107961.1 I 0.628
SapurV1A.0033s0530 Salix purpurea SapurV1A.0033s0530 I 0.628
Traes_2BL_8BEA9CE1B Triticum aestivum Traes_2BL_8BEA9CE1B I 0.628
Eucgr.E01474 Eucalyptus grandis Eucgr.E01474 I 0.628
evm.TU.supercontig_145.3 Carica papaya evm.TU.supercontig_145.3 I 0.628
Gorai.001G174800 Gossypium raimondii Gorai.001G174800 I 0.628
TCM_016030 Theobroma cacao TCM_016030 I 0.628
Pavir.Ga00891 Panicum virgatum Pavir.Ga00891 I 0.628
Pavir.Gb00743 Panicum virgatum Pavir.Gb00743 I 0.628
cassava43469.valid.m1 Manihot esculenta cassava43469.valid.m1 I 0.628
SapurV1A.1275s0050 Salix purpurea SapurV1A.1275s0050 I 0.628
28200.m000191 Ricinus communis 28200.m000191 I 0.628
MDP0000192940 Malus domestica MDP0000192940 I 0.628
VIT_15s0048g00550 Vitis vinifera VIT_15s0048g00550 I 0.628
SapurV1A.2672s0010 Salix purpurea SapurV1A.2672s0010 I 0.628
SapurV1A.0217s0100 Salix purpurea SapurV1A.0217s0100 I 0.628
Ca_25981 Cicer arietinum Ca_25981 I 0.628
MDP0000298333 Malus domestica MDP0000298333 I 0.628
Pm017846 Prunus mume Pm017846 I 0.628
mgf011463m Mimulus guttatus mgf011463m I 0.628
mgf015806m Mimulus guttatus mgf015806m I 0.628
Cla011745 Citrullus lanatus Cla011745 I 0.628
Pm023555 Prunus mume Pm023555 I 0.628
VIT_02s0154g00070 Vitis vinifera VIT_02s0154g00070 I 0.628
orange1.1g027215m.g Citrus sinensis orange1.1g027215m.g I 0.628
Lus10036496.g Linum usitatissimum Lus10036496.g I 0.628
Pavir.Aa01223 Panicum virgatum Pavir.Aa01223 I 0.628
SapurV1A.0248s0170 Salix purpurea SapurV1A.0248s0170 I 0.628
Traes_6DL_59DB06B9F Triticum aestivum Traes_6DL_59DB06B9F I 0.628
Traes_6BL_3F8DB6043 Triticum aestivum Traes_6BL_3F8DB6043 I 0.628
TRIUR3_27479 Triticum urartu TRIUR3_27479 I 0.628
TRIUR3_29073 Triticum urartu TRIUR3_29073 I 0.628
orange1.1g028144m.g Citrus sinensis orange1.1g028144m.g I 0.628
mgf003166m Mimulus guttatus mgf003166m I 0.628
30174.m008839 Ricinus communis 30174.m008839 I 0.628
Gorai.008G236500 Gossypium raimondii Gorai.008G236500 I 0.628
Traes_6AL_2983D4EB6 Triticum aestivum Traes_6AL_2983D4EB6 I 0.628
Sb01g017560 Sorghum bicolor Sb01g017560 I 0.628
ONIVA04G18220 Oryza nivara ONIVA04G18220 I 0.628
GLYMA17G14710 Glycine max GLYMA17G14710 I 0.628
ONIVA04G21490 Oryza nivara ONIVA04G21490 I 0.628
OPUNC02G23520 Oryza punctata OPUNC02G23520 I 0.628
ONIVA02G28110 Oryza nivara ONIVA02G28110 I 0.628
GRMZM2G005353 Zea mays GRMZM2G005353 I 0.628
OMERI04G17000 Oryza meridionalis OMERI04G17000 I 0.628
GRMZM2G074543 Zea mays GRMZM2G074543 I 0.628
OMERI10G11950 Oryza meridionalis OMERI10G11950 I 0.628
GRMZM2G054795 Zea mays GRMZM2G054795 I 0.628
OPUNC10G13730 Oryza punctata OPUNC10G13730 I 0.628
ORGLA02G0220100 Oryza glaberrima ORGLA02G0220100 I 0.628
YAB3 Oryza sativa OS10G0508300 I 0.628
GLYMA05G04260 Glycine max GLYMA05G04260 I 0.628
GLYMA03G03500 Glycine max GLYMA03G03500 I 0.628
GLYMA01G33370 Glycine max GLYMA01G33370 I 0.628
YAB5 Oryza sativa OS04G0536300 I 0.628
YAB4 Oryza sativa OS02G0643200 I 0.628
ORGLA04G0171000 Oryza glaberrima ORGLA04G0171000 I 0.628
ORUFI04G21570 Oryza rufipogon ORUFI04G21570 I 0.628
ORUFI10G16240 Oryza rufipogon ORUFI10G16240 I 0.628
OMERI02G25190 Oryza meridionalis OMERI02G25190 I 0.628
OLONG_018621 Oryza longistaminata OLONG_018621 I 0.628
MLOC_60897 Hordeum vulgare MLOC_60897 I 0.628
MLOC_70653 Hordeum vulgare MLOC_70653 I 0.628
MTR_4g025900 Medicago truncatula MTR_4g025900 I 0.628
MTR_4g101660 Medicago truncatula MTR_4g101660 I 0.628
GSMUA_Achr11G17520_001 Musa acuminata GSMUA_Achr11G17520_001 I 0.628
LPERR10G11580 Leersia perrieri LPERR10G11580 I 0.628
GSMUA_Achr8G11580_001 Musa acuminata GSMUA_Achr8G11580_001 I 0.628
GSMUA_Achr7G07130_001 Musa acuminata GSMUA_Achr7G07130_001 I 0.628
LPERR02G20990 Leersia perrieri LPERR02G20990 I 0.628
LPERR04G16190 Leersia perrieri LPERR04G16190 I 0.628
GSMUA_Achr11G03800_001 Musa acuminata GSMUA_Achr11G03800_001 I 0.628
OB02G33040 Oryza brachyantha OB02G33040 I 0.628
OGLUM02G26190 Oryza glumaepatula OGLUM02G26190 I 0.628
OGLUM04G19890 Oryza glumaepatula OGLUM04G19890 I 0.628
GRMZM2G167824 Zea mays GRMZM2G167824 I 0.628
OGLUM10G15140 Oryza glumaepatula OGLUM10G15140 I 0.628
OBART10G15260 Oryza barthii OBART10G15260 I 0.628
OBART04G20010 Oryza barthii OBART04G20010 I 0.628
OB04G27010 Oryza brachyantha OB04G27010 I 0.628
GRMZM2G529859 Zea mays GRMZM2G529859 I 0.628
OBART02G25670 Oryza barthii OBART02G25670 I 0.628
PGSC0003DMG400025969 Solanum tuberosum PGSC0003DMG400025969 I 0.628
ORUFI02G27080 Oryza rufipogon ORUFI02G27080 I 0.628
POPTR_0014s06210 Populus trichocarpa POPTR_0014s06210 I 0.628
PRUPE_ppa010905mg Prunus persica PRUPE_ppa010905mg I 0.628
POPTR_0003s11230 Populus trichocarpa POPTR_0003s11230 I 0.628
POPTR_0002s14600 Populus trichocarpa POPTR_0002s14600 I 0.628
BRADI3G50050 Brachypodium distachyon BRADI3G50050 I 0.628
POPTR_0001s00240 Populus trichocarpa POPTR_0001s00240 I 0.628
PRUPE_ppa011209mg Prunus persica PRUPE_ppa011209mg I 0.628
BGIOSGA014650 Oryza indica BGIOSGA014650 I 0.628
Si036788m.g Setaria italica Si036788m.g I 0.628
Solyc01g091010.2 Solanum lycopersicum Solyc01g091010.2 I 0.628
Si018146m.g Setaria italica Si018146m.g I 0.628
Si010859m.g Setaria italica Si010859m.g I 0.628
Sb04g033590 Sorghum bicolor Sb04g033590 I 0.628
Sb06g023770 Sorghum bicolor Sb06g023770 I 0.628
BRADI5G16910 Brachypodium distachyon BRADI5G16910 I 0.628
BRADI3G30410 Brachypodium distachyon BRADI3G30410 I 0.628
TCM_005549 Theobroma cacao TCM_005549 I 0.628
F775_25525 Aegilops tauschii F775_25525 I 0.628
F775_27799 Aegilops tauschii F775_27799 I 0.628
Bostr.22545s0001 Boechera stricta Bostr.22545s0001 I 0.627
Thhalv10017320m.g Eutrema salsugineum Thhalv10017320m.g I 0.627
orange1.1g028980m.g Citrus sinensis orange1.1g028980m.g I 0.627
Pm027559 Prunus mume Pm027559 I 0.627
Bo3g041840 Brassica oleracea Bo3g041840 I 0.627
PRUPE_ppa012028mg Prunus persica PRUPE_ppa012028mg I 0.627
cassava13509.valid.m1 Manihot esculenta cassava13509.valid.m1 I 0.627
SapurV1A.1100s0080 Salix purpurea SapurV1A.1100s0080 I 0.627
Aquca_020_00105 Aquilegia coerulea Aquca_020_00105 I 0.627
Lus10019407.g Linum usitatissimum Lus10019407.g I 0.627
YAB5 Arabidopsis thaliana AT2G26580 D 0.627
TCM_038105 Theobroma cacao TCM_038105 I 0.627
PK09461.1 Cannabis sativa PK09461.1 I 0.627
Ciclev10009560m.g Citrus clementina Ciclev10009560m.g I 0.627
Eucgr.C01515 Eucalyptus grandis Eucgr.C01515 I 0.627
Gorai.009G016700 Gossypium raimondii Gorai.009G016700 I 0.627
Solyc07g008180.2 Solanum lycopersicum Solyc07g008180.2 I 0.627
Carubv10024208m.g Capsella rubella Carubv10024208m.g I 0.627
Cla012424 Citrullus lanatus Cla012424 I 0.627
PGSC0003DMG400002883 Solanum tuberosum PGSC0003DMG400002883 I 0.627
PGSC0003DMG400030904 Solanum tuberosum PGSC0003DMG400030904 I 0.627
MTR_4g114730 Medicago truncatula MTR_4g114730 I 0.627
Solyc12g009580.1 Solanum lycopersicum Solyc12g009580.1 I 0.627
Cla016962 Citrullus lanatus Cla016962 I 0.627
Cagra.11302s0003 Capsella grandiflora Cagra.11302s0003 I 0.627
mgf015972m Mimulus guttatus mgf015972m I 0.627
YAB5 Vitis vinifera VIT_11s0016g05590 I 0.627
GLYMA17G12200 Glycine max GLYMA17G12200 I 0.627
Cucsa.132170 Cucumis sativus Cucsa.132170 I 0.627
YAB5 Arabidopsis lyrata fgenesh2_kg.4__584__AT2G26580.2 I 0.627
29927.m000626 Ricinus communis 29927.m000626 I 0.627
Ca_06681 Cicer arietinum Ca_06681 I 0.627
SapurV1A.0034s0500 Salix purpurea SapurV1A.0034s0500 I 0.627
MDP0000255415 Malus domestica MDP0000255415 I 0.627
evm.TU.supercontig_46.14 Carica papaya evm.TU.supercontig_46.14 I 0.627
gene31056-v1.0-hybrid Fragaria vesca gene31056-v1.0-hybrid I 0.627
cassava33847.m1 Manihot esculenta cassava33847.m1 I 0.627
GLYMA13G22620 Glycine max GLYMA13G22620 I 0.627
POPTR_0006s06700 Populus trichocarpa POPTR_0006s06700 I 0.627
Cucsa.295080 Cucumis sativus Cucsa.295080 I 0.627
Bra000538 Brassica rapa Bra000538 I 0.627
POPTR_0018s12990 Populus trichocarpa POPTR_0018s12990 I 0.627
mgf010765m Mimulus guttatus mgf010765m I 0.627
cassava13510.valid.m1 Manihot esculenta cassava13510.valid.m1 I 0.627
GSMUA_Achr4G22750_001 Musa acuminata GSMUA_Achr4G22750_001 I 0.627
Gorai.001G042700 Gossypium raimondii Gorai.001G042700 I 0.627
chr2.CM0237.250.nd Lotus japonicus chr2.CM0237.250.nd I 0.625
cassava17722.valid.m1 Manihot esculenta cassava17722.valid.m1 I 0.622
Gorai.009G367100 Gossypium raimondii Gorai.009G367100 I 0.621
Gorai.002G054200 Gossypium raimondii Gorai.002G054200 I 0.621
TCM_031868 Theobroma cacao TCM_031868 I 0.621
Aquca_006_00412 Aquilegia coerulea Aquca_006_00412 I 0.619
GSMUA_Achr4G31310_001 Musa acuminata GSMUA_Achr4G31310_001 I 0.617
Cla005767 Citrullus lanatus Cla005767 I 0.612
GSMUA_Achr3G25660_001 Musa acuminata GSMUA_Achr3G25660_001 I 0.611
LPERR07G16630 Leersia perrieri LPERR07G16630 I 0.611
GSMUA_Achr5G23610_001 Musa acuminata GSMUA_Achr5G23610_001 I 0.611
PDK_20s1781371g001 Phoenix dactylifera PDK_20s1781371g001 I 0.609
Eucgr.B03310 Eucalyptus grandis Eucgr.B03310 I 0.601
Lus10029135.g Linum usitatissimum Lus10029135.g I 0.600
Pm006709 Prunus mume Pm006709 I 0.600
POPTR_0010s05220 Populus trichocarpa POPTR_0010s05220 I 0.600
cassava26804.m1 Manihot esculenta cassava26804.m1 I 0.600
SapurV1A.0069s0070 Salix purpurea SapurV1A.0069s0070 I 0.600
SapurV1A.0269s0230 Salix purpurea SapurV1A.0269s0230 I 0.600
PRUPE_ppa023883mg Prunus persica PRUPE_ppa023883mg I 0.600
Carubv10012024m.g Capsella rubella Carubv10012024m.g I 0.600
Cagra.0605s0067 Capsella grandiflora Cagra.0605s0067 I 0.600
Lus10013028.g Linum usitatissimum Lus10013028.g I 0.600
orange1.1g037247m.g Citrus sinensis orange1.1g037247m.g I 0.592
MDP0000126221 Malus domestica MDP0000126221 I 0.592
chr2.CM0008.270.nc Lotus japonicus chr2.CM0008.270.nc I 0.592
MDP0000263713 Malus domestica MDP0000263713 I 0.592
MTR_5g034030 Medicago truncatula MTR_5g034030 I 0.592
cassava41595.m1 Manihot esculenta cassava41595.m1 I 0.592
cassava27370.m1 Manihot esculenta cassava27370.m1 I 0.586
Lus10030892.g Linum usitatissimum Lus10030892.g I 0.581
Ciclev10033714m.g Citrus clementina Ciclev10033714m.g I 0.581
Traes_3AL_730255B9F Triticum aestivum Traes_3AL_730255B9F I 0.579
GRMZM2G046829 Zea mays GRMZM2G046829 I 0.573
GLYMA04G10125 Glycine max GLYMA04G10125 I 0.572
BATDEDRAFT_7789 Batrachochytrium dendrobatidis BATDEDRAFT_7789 I 0.569
OLONG_001420 Oryza longistaminata OLONG_001420 I 0.567
BGIOSGA025976 Oryza indica BGIOSGA025976 I 0.567
OB07G25220 Oryza brachyantha OB07G25220 I 0.567
OMERI07G16070 Oryza meridionalis OMERI07G16070 I 0.567
ORGLA07G0250200 Oryza glaberrima ORGLA07G0250200 I 0.567
Ca_21472 Cicer arietinum Ca_21472 I 0.564
Cla000824 Citrullus lanatus Cla000824 I 0.563
GLYMA06G10110 Glycine max GLYMA06G10110 I 0.563
mgf023167m Mimulus guttatus mgf023167m I 0.563
Solyc05g005240.1 Solanum lycopersicum Solyc05g005240.1 I 0.563
Cucsa.394330 Cucumis sativus Cucsa.394330 I 0.563
EuGene.0000040541 Micromonas pusilla EuGene.0000040541 I 0.561
Pavir.Bb03145 Panicum virgatum Pavir.Bb03145 I 0.561
GLYMA01G03580 Glycine max GLYMA01G03580 I 0.561
Pavir.Ba00601 Panicum virgatum Pavir.Ba00601 I 0.561
AZW_EuGene.0200010417 Micromonas sp RCC299 AZW_EuGene.0200010417 I 0.557
INO Arabidopsis lyrata fgenesh1_pg.C_scaffold_1002152 I 0.556
Bo5g039580 Brassica oleracea Bo5g039580 I 0.556
Bo7g056180 Brassica oleracea Bo7g056180 I 0.556
evm.TU.supercontig_69.72 Carica papaya evm.TU.supercontig_69.72 I 0.556
INO Arabidopsis thaliana AT1G23420 D 0.556
Thhalv10008669m.g Eutrema salsugineum Thhalv10008669m.g I 0.556
Bostr.12659s0203 Boechera stricta Bostr.12659s0203 I 0.556
Bra024599 Brassica rapa Bra024599 I 0.556
Bra012373 Brassica rapa Bra012373 I 0.556
GUITHDRAFT_163519 Guillardia theta GUITHDRAFT_163519 I 0.530
Cla010239 Citrullus lanatus Cla010239 I 0.528
SPPG_09438 Spizellomyces punctatus SPPG_09438 I 0.525
Gorai.007G089700 Gossypium raimondii Gorai.007G089700 I 0.520
GLOINDRAFT_342259 Rhizophagus irregularis GLOINDRAFT_342259 I 0.519
EMIHUDRAFT_98817 Emiliania huxleyi EMIHUDRAFT_98817 I 0.519
SPPG_01639 Spizellomyces punctatus SPPG_01639 I 0.519
EMIHUDRAFT_114782 Emiliania huxleyi EMIHUDRAFT_114782 I 0.519
GLOINDRAFT_347422 Rhizophagus irregularis GLOINDRAFT_347422 I 0.514
Cucsa.286190 Cucumis sativus Cucsa.286190 I 0.508
AMAG_02504 Allomyces macrogynus AMAG_02504 I 0.506
Lus10030596.g Linum usitatissimum Lus10030596.g I 0.498
PFL1_06190 Pseudozyma flocculosa PFL1_06190 I 0.496
GLOINDRAFT_337448 Rhizophagus irregularis GLOINDRAFT_337448 I 0.491
29631.m001046 Ricinus communis 29631.m001046 I 0.482
M407DRAFT_126438 Tulasnella calospora M407DRAFT_126438 I 0.481
GUITHDRAFT_146350 Guillardia theta GUITHDRAFT_146350 I 0.477
DACRYDRAFT_54873 Dacryopinax sp DACRYDRAFT_54873 I 0.475
PISMIDRAFT_671062 Pisolithus microcarpus PISMIDRAFT_671062 I 0.471
GLOTRDRAFT_11089 Gloeophyllum trabeum GLOTRDRAFT_11089 I 0.471
RTG_00107 Rhodotorula glutinis RTG_00107 I 0.468
sr16632 Sporisorium reilianum sr16632 I 0.462
UM06001 Ustilago maydis UM06001 I 0.462
CND03770 Cryptococcus neoformans CND03770 I 0.460
Moror_16065 Moniliophthora roreri Moror_16065 I 0.453
SNAPOd2T00002710001 Oikopleura dioica SNAPOd2T00002710001 I 0.451
CY34DRAFT_417575 Suillus luteus CY34DRAFT_417575 I 0.443
HETIRDRAFT_308278 Heterobasidion irregulare HETIRDRAFT_308278 I 0.442
e_gw1.1.2342.1 Heterobasidion annosum e_gw1.1.2342.1 I 0.442
PISMIDRAFT_684224 Pisolithus microcarpus PISMIDRAFT_684224 I 0.440
AMAG_00993 Allomyces macrogynus AMAG_00993 I 0.438
M422DRAFT_175451 Sphaerobolus stellatus M422DRAFT_175451 I 0.438
PLICRDRAFT_179042 Plicaturopsis crispa PLICRDRAFT_179042 I 0.438
PILCRDRAFT_822980 Piloderma croceum PILCRDRAFT_822980 I 0.438
SERLA73DRAFT_131740 Serpula lacrymans SERLA73DRAFT_131740 I 0.436
PSEUBRA_SCAF20g03069 Pseudozyma brasiliensis PSEUBRA_SCAF20g03069 I 0.434
PAN0_018d5604 Pseudozyma antarctica PAN0_018d5604 I 0.434
UHOR_08529 Ustilago hordei UHOR_08529 I 0.434
PaG_05633 Pseudozyma aphidis PaG_05633 I 0.434
JAAARDRAFT_119170 Jaapia argillacea JAAARDRAFT_119170 I 0.433
CMT447C Cyanidioschyzon merolae CMT447C I 0.432
RHTO_01283 Rhodosporidium toruloides RHTO_01283 I 0.430
K437DRAFT_256012 Tilletiaria anomala K437DRAFT_256012 I 0.428
PLEOSDRAFT_155914 Pleurotus ostreatus PLEOSDRAFT_155914 I 0.427
PAXRUDRAFT_821077 Paxillus rubicundulus PAXRUDRAFT_821077 I 0.427
MYCTH_2308522 Myceliophthora thermophila MYCTH_2308522 I 0.421
fgenesh1_pg.C_scaffold_10000074 Cryphonectria parasitica fgenesh1_pg.C_scaffold_10000074 I 0.421
fgenesh1_pg.chr_5_#_192 Ostreococcus RCC809 fgenesh1_pg.chr_5_#_192 N 0.421
TRIVIDRAFT_16124 Trichoderma virens TRIVIDRAFT_16124 N 0.421
THITE_22048 Thielavia terrestris THITE_22048 I 0.419
BOTBODRAFT_39377 Botryobasidium botryosum BOTBODRAFT_39377 I 0.417
GLOINDRAFT_334763 Rhizophagus irregularis GLOINDRAFT_334763 I 0.417