HHAL005242-PA (Halyomorpha halys)
Sox

TF Information

Pfam ID Interpro ID Gene ID CIS-BP ID Sequence source
PF00505 (HMG_box) IPR000910 HHAL005242-PA T334848_2.00 Misc (2018-Jan-19)
NCBI Gene Info:
This gene encodes a tumor suppressor protein containing transcriptional activation, DNA binding, and oligomerization domains. The encoded protein responds to diverse cellular stresses to regulate expression of target genes, thereby inducing cell cycle arrest, apoptosis, senescence, DNA repair, or changes in metabolism. Mutations in this gene are associated with a variety of human cancers, including hereditary cancers such as Li-Fraumeni syndrome. Alternative splicing of this gene and the use of alternate promoters result in multiple transcript variants and isoforms. Additional isoforms have also been shown to result from the use of alternate translation initiation codons from identical transcript variants (PMIDs: 12032546, 20937277). [provided by RefSeq, Dec 2016]

Directly determined binding motifs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
No direct experiments

Motifs from related TFs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
YAB5
M02486_2.00
Arabidopsis thaliana
NNNNHRN

NYDNNNN
PBM
Weirauch et al.(2014)
pTH7575
0.427 0.267
YAB5
M00889_2.00
Arabidopsis thaliana
NATRATTADNNN

NNNHTAATYATN
PBM
Franco-Zorrilla et al.(2014)
YAB5
0.427 0.267
YAB1
M00890_2.00
Arabidopsis thaliana
AATAATWA

TWATTATT
PBM
Franco-Zorrilla et al.(2014)
YAB1
0.427 0.267
CRC
M07266_2.00
Arabidopsis thaliana
TWATCATW

WATGATWA
Dap-seq
OMalley et al.(2016)
CRC_col_a
0.426 0.311
CRC
M07267_2.00
Arabidopsis thaliana
GGTTAGTGTTTTGGAGTCGAATATGACTTG

CAAGTCATATTCGACTCCAAAACACTAACC
Dap-seq
OMalley et al.(2016)
CRC_colamp_a
0.426 0.311
For this family, TFs with SR scores > 0.415 will likely have a similar motif

DNA Binding Domains

Protein ID Domain From To Sequence
HHAL005242-PA Sox 158 202

Links

Other Sox family TFs
Other Halyomorpha halys TFs

492 Related TFs

Name Species Gene ID Motif Evidence SR
Score
Action
KGM_20190 Danaus plexippus KGM_20190 I 0.699
CapteG224864 Capitella teleta CapteG224864 I 0.695
MCINX012524 Melitaea cinxia MCINX012524 I 0.692
NV13812 Nasonia vitripennis NV13812 I 0.690
HelroG66455 Helobdella robusta HelroG66455 N 0.686
DICVIV_03175 Dictyocaulus viviparus DICVIV_03175 N 0.682
MDOA001488 Musca domestica MDOA001488 I 0.678
NEMVEDRAFT_v1g201358 Nematostella vectensis NEMVEDRAFT_v1g201358 I 0.672
Cflo_06133--XP_394373.1_APIME Camponotus floridanus Cflo_06133--XP_394373.1_APIME I 0.671
tetur18g00680 Tetranychus urticae tetur18g00680 I 0.670
GB50764 Apis mellifera GB50764 I 0.665
ACEP12759 Atta cephalotes ACEP12759 I 0.665
Hsal_04778--XP_394373.1_APIME Harpegnathos saltator Hsal_04778--XP_394373.1_APIME I 0.665
SINV12391 Solenopsis invicta SINV12391 I 0.665
ASU_10445 Ascaris suum ASU_10445 N 0.660
PEQ_0000413701 Parascaris equorum PEQ_0000413701 N 0.660
ALUE_0001851001 Ascaris lumbricoides ALUE_0001851001 N 0.660
HPLM_0000348901 Haemonchus placei HPLM_0000348901 N 0.654
ANCCEY_08672 Ancylostoma ceylanicum ANCCEY_08672 N 0.654
HMEL009197 Heliconius melpomene HMEL009197 N 0.654
HPBE_0001252601 Heligmosomoides bakeri HPBE_0001252601 N 0.654
TELCIR_11967 Teladorsagia circumcincta TELCIR_11967 N 0.654
HCOI00594600 Haemonchus contortus HCOI00594600 N 0.654
OESDEN_05486 Oesophagostomum dentatum OESDEN_05486 N 0.654
NECAME_12352 Necator americanus NECAME_12352 N 0.654
ANCCAN_29654 Ancylostoma caninum ANCCAN_29654 N 0.654
NBR_0000605501 Nippostrongylus brasiliensis NBR_0000605501 N 0.654
ACOC_0001323101 Angiostrongylus costaricensis ACOC_0001323101 N 0.654
ACAC_0000409101 Angiostrongylus cantonensis ACAC_0000409101 N 0.654
PHUM036320 Pediculus humanus PHUM036320 N 0.653
Ocbimv22013575m.g Octopus bimaculoides Ocbimv22013575m.g I 0.652
ISCW011313 Ixodes scapularis ISCW011313 N 0.649
Y73E7A.1 Caenorhabditis elegans WBGene00022268 N 0.649
RPRC009760 Rhodnius prolixus RPRC009760 N 0.648
BGIBMGA013514 Bombyx mori BGIBMGA013514 N 0.647
CBN09380 Caenorhabditis brenneri CBN09380 N 0.643
CRE03905 Caenorhabditis remanei CRE03905 N 0.643
CJA05209 Caenorhabditis japonica CJA05209 N 0.643
TCLT_0001081001 Thelazia callipaeda TCLT_0001081001 N 0.624
MhA1_Contig1250.frz3.gene10 Meloidogyne hapla MhA1_Contig1250.frz3.gene10 N 0.624
maker-nMf.1.1.scaf18285-snap-gene-0.4 Meloidogyne floridensis maker-nMf.1.1.scaf18285-snap-gene-0.4 N 0.624
GPUH_0000676401 Gongylonema pulchrum GPUH_0000676401 N 0.624
Minc12734 Meloidogyne incognita Minc12734 N 0.624
CPIJ005084 Culex quinquefasciatus CPIJ005084 N 0.614
CpipJ_CPIJ005084 Culex pipiens CpipJ_CPIJ005084 N 0.614
LotgiG126557 Lottia gigantea LotgiG126557 N 0.614
estExt_fgenesh2_pm.C_3240002 Branchiostoma floridae estExt_fgenesh2_pm.C_3240002 N 0.613
estExt_fgenesh2_pg.C_1070085 Branchiostoma floridae estExt_fgenesh2_pg.C_1070085 N 0.613
ACYPI003297 Acyrthosiphon pisum ACYPI003297 I 0.607
DAPPUDRAFT_303074 Daphnia pulex DAPPUDRAFT_303074 N 0.606
ASTEI04275 Anopheles stephensi ASTEI04275 N 0.600
ACOM033320 Anopheles coluzzii ACOM033320 N 0.600
ACHR002403 Anopheles christyi ACHR002403 N 0.600
ASIS023527 Anopheles sinensis ASIS023527 N 0.600
AQUA009805 Anopheles quadriannulatus AQUA009805 N 0.600
ACUA003510 Anopheles culicifacies ACUA003510 N 0.600
AMEC005071 Anopheles melas AMEC005071 N 0.600
AEPI008570 Anopheles epiroticus AEPI008570 N 0.600
AARA009694 Anopheles arabiensis AARA009694 N 0.600
AMEM002948 Anopheles merus AMEM002948 N 0.600
AGAP004110 Anopheles gambiae AGAP004110 N 0.600
GH18160 Drosophila grimshawi FBgn0125628 I 0.597
GK13574 Drosophila willistoni FBgn0215582 I 0.597
GE25578 Drosophila yakuba FBgn0242642 I 0.597
maker-pir_contig_430-fgenesh-gene-0.3 Pythium irregulare maker-pir_contig_430-fgenesh-gene-0.3 N 0.596
maker-piw_contig_1911-snap-gene-0.6 Pythium iwayamai maker-piw_contig_1911-snap-gene-0.6 N 0.596
Physo132366 Phytophthora sojae Physo132366 N 0.596
PYU1_G003004 Pythium ultimum PYU1_G003004 N 0.596
SPRG_06372 Saprolegnia parasitica SPRG_06372 N 0.596
fgenesh_scip_prom.46568.2049 Phytophthora kernoviae fgenesh_scip_prom.46568.2049 N 0.596
fgenesh1_pg.C_scaffold_73784000001 Phytophthora capsici fgenesh1_pg.C_scaffold_73784000001 N 0.596
estExt_fgenesh1_kg.C_80399 Phytophthora capsici estExt_fgenesh1_kg.C_80399 N 0.596
CLEC002888 Cimex lectularius CLEC002888 N 0.596
F443_19335 Phytophthora parasitica F443_19335 N 0.596
SBAD_0000307901 Soboliphyme baturini SBAD_0000307901 N 0.595
LCUP006380 Lucilia cuprina LCUP006380 N 0.582
CGI_10019404 Crassostrea gigas CGI_10019404 N 0.576
SPU_001776 Strongylocentrotus purpuratus SPU_001776 N 0.574
Phyra74523 Phytophthora ramorum Phyra74523 N 0.571
fgenesh_scip_prom.28083.7036 Phytophthora lateralis fgenesh_scip_prom.28083.7036 N 0.571
AATE006267 Anopheles atroparvus AATE006267 N 0.568
AFUN011346 Anopheles funestus AFUN011346 N 0.568
AFAF018499 Anopheles farauti AFAF018499 N 0.568
ADAC009894 Anopheles darlingi ADAC009894 N 0.568
ADIR002941 Anopheles dirus ADIR002941 N 0.568
AALB007196 Anopheles albimanus AALB007196 N 0.568
AMIN003838 Anopheles minimus AMIN003838 N 0.568
ccdc124 Oryzias latipes ENSORLG00000015728 N 0.555
maker-pve_contig_105-snap-gene-0.29 Pythium vexans maker-pve_contig_105-snap-gene-0.29 N 0.552
TRE_0001918901 Trichobilharzia regenti TRE_0001918901 N 0.551
TC004658 Tribolium castaneum TC004658 N 0.549
ALNC14_126360 Albugo laibachii ALNC14_126360 N 0.540
Sjc_0011880 Schistosoma japonicum Sjc_0011880 N 0.538
SMRZ_0002114501 Schistosoma margrebowiei SMRZ_0002114501 N 0.531
Smp_004360 Schistosoma mansoni Smp_004360 N 0.531
A_06553 Schistosoma haematobium A_06553 N 0.531
AAEL008417 Aedes aegypti AAEL008417 N 0.529
GUITHDRAFT_162866 Guillardia theta GUITHDRAFT_162866 N 0.528
AMAM021723 Anopheles maculatus AMAM021723 N 0.523
ML11467a Mnemiopsis leidyi ML11467a N 0.522
DILT_0001250601 Diphyllobothrium latum DILT_0001250601 N 0.518
EFV51436 Trichinella spiralis EFV51436 N 0.508
D917_07703 Trichinella nativa D917_07703 N 0.508
D918_07944 Trichuris suis D918_07944 N 0.493
CLEC000086 Cimex lectularius CLEC000086 N 0.490
ETH_00032160 Eimeria tenella ETH_00032160 N 0.479
TGME49_037260 Toxoplasma gondii TGME49_037260 N 0.479
ENSCING00000023833 Ciona intestinalis ENSCING00000023833 N 0.471
ECPE_0001800901 Echinostoma caproni ECPE_0001800901 N 0.467
mgf019496m Mimulus guttatus mgf019496m I 0.461
fgenesh1_pm.2_#_13 Coccomyxa subellipsoidea C169 fgenesh1_pm.2_#_13 N 0.453
fgeneshCV_pg.C_scaffold_2000022 Chlorella vulgaris fgeneshCV_pg.C_scaffold_2000022 N 0.453
TTRE_0000309701 Trichuris trichiura TTRE_0000309701 N 0.447
NCLIV_051130 Neospora caninum NCLIV_051130 N 0.441
SMU15012775 Schmidtea mediterranea SMU15012775 N 0.437
GLOINDRAFT_342259 Rhizophagus irregularis GLOINDRAFT_342259 I 0.435
CHD4 Ochotona princeps ENSOPRG00000003477 N 0.434
ENSSHAG00000004107 Sarcophilus harrisii ENSSHAG00000004107 N 0.434
XP_002941963 Xenopus tropicalis XP_002941963 N 0.434
ENSMODG00000024829 Monodelphis domestica ENSMODG00000024829 N 0.434
cgd2_870 Cryptosporidium parvum cgd2_870 N 0.434
CHD4 Microcebus murinus ENSMICG00000006588 N 0.434
CHD4 Echinops telfairi ENSETEG00000005912 N 0.434
Bo8g055830 Brassica oleracea Bo8g055830 I 0.433
T265_00523 Opisthorchis viverrini T265_00523 N 0.433
BATDEDRAFT_89306 Batrachochytrium dendrobatidis BATDEDRAFT_89306 N 0.432
Lus10024603.g Linum usitatissimum Lus10024603.g I 0.431
PGSC0003DMG400028360 Solanum tuberosum PGSC0003DMG400028360 I 0.431
SapurV1A.0248s0170 Salix purpurea SapurV1A.0248s0170 I 0.431
Solyc05g012050.2 Solanum lycopersicum Solyc05g012050.2 I 0.431
POPTR_0008s19330 Populus trichocarpa POPTR_0008s19330 I 0.431
Lus10032240.g Linum usitatissimum Lus10032240.g I 0.431
TRIUR3_27402 Triticum urartu TRIUR3_27402 I 0.427
TRIUR3_18590 Triticum urartu TRIUR3_18590 I 0.427
cassava43469.valid.m1 Manihot esculenta cassava43469.valid.m1 I 0.427
Traes_6DL_59DB06B9F Triticum aestivum Traes_6DL_59DB06B9F I 0.427
cassava30083.valid.m1 Manihot esculenta cassava30083.valid.m1 I 0.427
cassava39022.m1 Manihot esculenta cassava39022.m1 I 0.427
cassava33847.m1 Manihot esculenta cassava33847.m1 I 0.427
cassava40986.m1 Manihot esculenta cassava40986.m1 I 0.427
Cucsa.320600 Cucumis sativus Cucsa.320600 I 0.427
mgf011463m Mimulus guttatus mgf011463m I 0.427
mgf010765m Mimulus guttatus mgf010765m I 0.427
mgf015806m Mimulus guttatus mgf015806m I 0.427
mgf015972m Mimulus guttatus mgf015972m I 0.427
Traes_6BL_3F8DB6043 Triticum aestivum Traes_6BL_3F8DB6043 I 0.427
mgf009982m Mimulus guttatus mgf009982m I 0.427
mgf003166m Mimulus guttatus mgf003166m I 0.427
Cucsa.132170 Cucumis sativus Cucsa.132170 I 0.427
Cucsa.295080 Cucumis sativus Cucsa.295080 I 0.427
Cucsa.302100 Cucumis sativus Cucsa.302100 I 0.427
cassava17722.valid.m1 Manihot esculenta cassava17722.valid.m1 I 0.427
Cucsa.086660 Cucumis sativus Cucsa.086660 I 0.427
29927.m000626 Ricinus communis 29927.m000626 I 0.427
Cla012424 Citrullus lanatus Cla012424 I 0.427
YAB5 Vitis vinifera VIT_11s0016g05590 I 0.427
Cla016962 Citrullus lanatus Cla016962 I 0.427
Pm001547 Prunus mume Pm001547 I 0.427
VIT_08s0032g01110 Vitis vinifera VIT_08s0032g01110 I 0.427
Cla011745 Citrullus lanatus Cla011745 I 0.427
Cla008752 Citrullus lanatus Cla008752 I 0.427
Ca_07101 Cicer arietinum Ca_07101 I 0.427
Ca_06681 Cicer arietinum Ca_06681 I 0.427
LjSGA_107961.1 Lotus japonicus LjSGA_107961.1 I 0.427
Ca_25981 Cicer arietinum Ca_25981 I 0.427
VIT_15s0048g00550 Vitis vinifera VIT_15s0048g00550 I 0.427
YAB2 Vitis vinifera VIT_06s0009g00880 I 0.427
Pm017846 Prunus mume Pm017846 I 0.427
30174.m008839 Ricinus communis 30174.m008839 I 0.427
29854.m001136 Ricinus communis 29854.m001136 I 0.427
cassava13509.valid.m1 Manihot esculenta cassava13509.valid.m1 I 0.427
TRIUR3_27479 Triticum urartu TRIUR3_27479 I 0.427
cassava13510.valid.m1 Manihot esculenta cassava13510.valid.m1 I 0.427
PK06964.1 Cannabis sativa PK06964.1 I 0.427
PK09461.1 Cannabis sativa PK09461.1 I 0.427
Pm027559 Prunus mume Pm027559 I 0.427
Pm023555 Prunus mume Pm023555 I 0.427
28200.m000191 Ricinus communis 28200.m000191 I 0.427
VIT_02s0154g00070 Vitis vinifera VIT_02s0154g00070 I 0.427
TRIUR3_29073 Triticum urartu TRIUR3_29073 I 0.427
cassava13963.valid.m1 Manihot esculenta cassava13963.valid.m1 I 0.427
Cagra.0239s0072 Capsella grandiflora Cagra.0239s0072 I 0.427
SapurV1A.1100s0080 Salix purpurea SapurV1A.1100s0080 I 0.427
MDP0000252640 Malus domestica MDP0000252640 I 0.427
MDP0000192940 Malus domestica MDP0000192940 I 0.427
SapurV1A.0634s0130 Salix purpurea SapurV1A.0634s0130 I 0.427
SapurV1A.0288s0210 Salix purpurea SapurV1A.0288s0210 I 0.427
MDP0000255415 Malus domestica MDP0000255415 I 0.427
SapurV1A.0217s0100 Salix purpurea SapurV1A.0217s0100 I 0.427
SapurV1A.0258s0090 Salix purpurea SapurV1A.0258s0090 I 0.427
Lus10036496.g Linum usitatissimum Lus10036496.g I 0.427
SapurV1A.1275s0050 Salix purpurea SapurV1A.1275s0050 I 0.427
Gorai.010G062900 Gossypium raimondii Gorai.010G062900 I 0.427
Gorai.009G016700 Gossypium raimondii Gorai.009G016700 I 0.427
Gorai.008G236500 Gossypium raimondii Gorai.008G236500 I 0.427
Lus10010361.g Linum usitatissimum Lus10010361.g I 0.427
SapurV1A.3336s0010 Salix purpurea SapurV1A.3336s0010 I 0.427
SapurV1A.2672s0010 Salix purpurea SapurV1A.2672s0010 I 0.427
Traes_6AL_2983D4EB6 Triticum aestivum Traes_6AL_2983D4EB6 I 0.427
Lus10019407.g Linum usitatissimum Lus10019407.g I 0.427
MDP0000298333 Malus domestica MDP0000298333 I 0.427
MDP0000331808 Malus domestica MDP0000331808 I 0.427
Pavir.Ga00891 Panicum virgatum Pavir.Ga00891 I 0.427
Pavir.Cb00070 Panicum virgatum Pavir.Cb00070 I 0.427
Pavir.Ca02862 Panicum virgatum Pavir.Ca02862 I 0.427
Pavir.Gb00743 Panicum virgatum Pavir.Gb00743 I 0.427
Pavir.Ia01130 Panicum virgatum Pavir.Ia01130 I 0.427
SapurV1A.0033s0530 Salix purpurea SapurV1A.0033s0530 I 0.427
Pavir.Ib04136 Panicum virgatum Pavir.Ib04136 I 0.427
Pavir.Ib03707 Panicum virgatum Pavir.Ib03707 I 0.427
Pavir.Ba03779 Panicum virgatum Pavir.Ba03779 I 0.427
Pavir.Ab02534 Panicum virgatum Pavir.Ab02534 I 0.427
orange1.1g027215m.g Citrus sinensis orange1.1g027215m.g I 0.427
MDP0000500810 Malus domestica MDP0000500810 I 0.427
MDP0000366291 Malus domestica MDP0000366291 I 0.427
orange1.1g028144m.g Citrus sinensis orange1.1g028144m.g I 0.427
orange1.1g028980m.g Citrus sinensis orange1.1g028980m.g I 0.427
Pavir.Aa01223 Panicum virgatum Pavir.Aa01223 I 0.427
orange1.1g029862m.g Citrus sinensis orange1.1g029862m.g I 0.427
Gorai.006G117800 Gossypium raimondii Gorai.006G117800 I 0.427
Thhalv10001617m.g Eutrema salsugineum Thhalv10001617m.g I 0.427
Carubv10010384m.g Capsella rubella Carubv10010384m.g I 0.427
Carubv10001833m.g Capsella rubella Carubv10001833m.g I 0.427
Cagra.4395s0036 Capsella grandiflora Cagra.4395s0036 I 0.427
Thhalv10017320m.g Eutrema salsugineum Thhalv10017320m.g I 0.427
Carubv10024011m.g Capsella rubella Carubv10024011m.g I 0.427
Ciclev10021834m.g Citrus clementina Ciclev10021834m.g I 0.427
Ciclev10009560m.g Citrus clementina Ciclev10009560m.g I 0.427
Carubv10024208m.g Capsella rubella Carubv10024208m.g I 0.427
Cagra.1261s0010 Capsella grandiflora Cagra.1261s0010 I 0.427
Cagra.11302s0003 Capsella grandiflora Cagra.11302s0003 I 0.427
Bostr.22545s0001 Boechera stricta Bostr.22545s0001 I 0.427
Bostr.14547s0027 Boechera stricta Bostr.14547s0027 I 0.427
Aquca_020_00105 Aquilegia coerulea Aquca_020_00105 I 0.427
Bostr.25219s0098 Boechera stricta Bostr.25219s0098 I 0.427
Bostr.25993s0255 Boechera stricta Bostr.25993s0255 I 0.427
Thhalv10028925m.g Eutrema salsugineum Thhalv10028925m.g I 0.427
SapurV1A.0034s0500 Salix purpurea SapurV1A.0034s0500 I 0.427
Ciclev10022170m.g Citrus clementina Ciclev10022170m.g I 0.427
Ciclev10029354m.g Citrus clementina Ciclev10029354m.g I 0.427
gene31056-v1.0-hybrid Fragaria vesca gene31056-v1.0-hybrid I 0.427
gene04566-v1.0-hybrid Fragaria vesca gene04566-v1.0-hybrid I 0.427
gene03938-v1.0-hybrid Fragaria vesca gene03938-v1.0-hybrid I 0.427
gene32251-v1.0-hybrid Fragaria vesca gene32251-v1.0-hybrid I 0.427
Gorai.001G042700 Gossypium raimondii Gorai.001G042700 I 0.427
Thhalv10008858m.g Eutrema salsugineum Thhalv10008858m.g I 0.427
Gorai.001G174800 Gossypium raimondii Gorai.001G174800 I 0.427
Gorai.001G127000 Gossypium raimondii Gorai.001G127000 I 0.427
evm.TU.supercontig_46.14 Carica papaya evm.TU.supercontig_46.14 I 0.427
evm.TU.supercontig_29.121 Carica papaya evm.TU.supercontig_29.121 I 0.427
Eucgr.E01474 Eucalyptus grandis Eucgr.E01474 I 0.427
Eucgr.D02474 Eucalyptus grandis Eucgr.D02474 I 0.427
Eucgr.C01515 Eucalyptus grandis Eucgr.C01515 I 0.427
Eucgr.J00587 Eucalyptus grandis Eucgr.J00587 I 0.427
evm.TU.supercontig_103.34 Carica papaya evm.TU.supercontig_103.34 I 0.427
evm.TU.supercontig_145.3 Carica papaya evm.TU.supercontig_145.3 I 0.427
evm.TU.supercontig_104.5 Carica papaya evm.TU.supercontig_104.5 I 0.427
Aquca_009_00652 Aquilegia coerulea Aquca_009_00652 I 0.427
Solyc01g091010.2 Solanum lycopersicum Solyc01g091010.2 I 0.427
GSMUA_Achr7G07130_001 Musa acuminata GSMUA_Achr7G07130_001 I 0.427
GSMUA_Achr7G07830_001 Musa acuminata GSMUA_Achr7G07830_001 I 0.427
GSMUA_Achr7G01330_001 Musa acuminata GSMUA_Achr7G01330_001 I 0.427
GSMUA_Achr6G31080_001 Musa acuminata GSMUA_Achr6G31080_001 I 0.427
GSMUA_Achr4G31310_001 Musa acuminata GSMUA_Achr4G31310_001 I 0.427
GSMUA_Achr8G11580_001 Musa acuminata GSMUA_Achr8G11580_001 I 0.427
LPERR02G20990 Leersia perrieri LPERR02G20990 I 0.427
LPERR10G11580 Leersia perrieri LPERR10G11580 I 0.427
LPERR07G03250 Leersia perrieri LPERR07G03250 I 0.427
LPERR04G16190 Leersia perrieri LPERR04G16190 I 0.427
LPERR03G22960 Leersia perrieri LPERR03G22960 I 0.427
GSMUA_Achr4G22750_001 Musa acuminata GSMUA_Achr4G22750_001 I 0.427
GSMUA_Achr2G12850_001 Musa acuminata GSMUA_Achr2G12850_001 I 0.427
GRMZM2G106204 Zea mays GRMZM2G106204 I 0.427
GRMZM2G085873 Zea mays GRMZM2G085873 I 0.427
GRMZM2G074543 Zea mays GRMZM2G074543 I 0.427
GRMZM2G074124 Zea mays GRMZM2G074124 I 0.427
GRMZM2G116646 Zea mays GRMZM2G116646 I 0.427
GRMZM2G141955 Zea mays GRMZM2G141955 I 0.427
GSMUA_Achr11G17520_001 Musa acuminata GSMUA_Achr11G17520_001 I 0.427
GSMUA_Achr11G03800_001 Musa acuminata GSMUA_Achr11G03800_001 I 0.427
GRMZM2G529859 Zea mays GRMZM2G529859 I 0.427
GRMZM2G167824 Zea mays GRMZM2G167824 I 0.427
MLOC_60897 Hordeum vulgare MLOC_60897 I 0.427
MLOC_66260 Hordeum vulgare MLOC_66260 I 0.427
OBART10G15260 Oryza barthii OBART10G15260 I 0.427
OBART04G20010 Oryza barthii OBART04G20010 I 0.427
OBART03G27740 Oryza barthii OBART03G27740 I 0.427
OBART02G25670 Oryza barthii OBART02G25670 I 0.427
OBART12G19190 Oryza barthii OBART12G19190 I 0.427
Traes_5DS_268147383 Triticum aestivum Traes_5DS_268147383 I 0.427
OGLUM12G20870 Oryza glumaepatula OGLUM12G20870 I 0.427
OGLUM10G15140 Oryza glumaepatula OGLUM10G15140 I 0.427
OGLUM04G19890 Oryza glumaepatula OGLUM04G19890 I 0.427
OGLUM03G28370 Oryza glumaepatula OGLUM03G28370 I 0.427
OB12G26050 Oryza brachyantha OB12G26050 I 0.427
OB07G12810 Oryza brachyantha OB07G12810 I 0.427
MTR_4g025900 Medicago truncatula MTR_4g025900 I 0.427
MTR_2g087740 Medicago truncatula MTR_2g087740 I 0.427
MLOC_70676 Hordeum vulgare MLOC_70676 I 0.427
MLOC_70653 Hordeum vulgare MLOC_70653 I 0.427
MTR_4g050300 Medicago truncatula MTR_4g050300 I 0.427
MTR_4g101660 Medicago truncatula MTR_4g101660 I 0.427
OB04G27010 Oryza brachyantha OB04G27010 I 0.427
OB03G35470 Oryza brachyantha OB03G35470 I 0.427
OB02G33040 Oryza brachyantha OB02G33040 I 0.427
MTR_4g114730 Medicago truncatula MTR_4g114730 I 0.427
GRMZM2G054795 Zea mays GRMZM2G054795 I 0.427
GRMZM2G005353 Zea mays GRMZM2G005353 I 0.427
Bo8g112450 Brassica oleracea Bo8g112450 I 0.427
Bo6g073320 Brassica oleracea Bo6g073320 I 0.427
Bo5g009010 Brassica oleracea Bo5g009010 I 0.427
Bo4g195410 Brassica oleracea Bo4g195410 I 0.427
Bo9g001130 Brassica oleracea Bo9g001130 I 0.427
Bra000378 Brassica rapa Bra000378 I 0.427
Bra030728 Brassica rapa Bra030728 I 0.427
Bra018624 Brassica rapa Bra018624 I 0.427
Bra003309 Brassica rapa Bra003309 I 0.427
Bra000538 Brassica rapa Bra000538 I 0.427
Bo3g041840 Brassica oleracea Bo3g041840 I 0.427
Bo3g037630 Brassica oleracea Bo3g037630 I 0.427
YAB2 Arabidopsis thaliana AT1G08465 I 0.427
AMTR_s00085p00032940 Amborella trichopoda AMTR_s00085p00032940 I 0.427
AMTR_s00078p00029420 Amborella trichopoda AMTR_s00078p00029420 I 0.427
AMTR_s00004p00165390 Amborella trichopoda AMTR_s00004p00165390 I 0.427
YAB5 Arabidopsis thaliana AT2G26580 D 0.427
YAB1 Arabidopsis thaliana AT2G45190 D 0.427
BGIOSGA037817 Oryza indica BGIOSGA037817 I 0.427
BGIOSGA014650 Oryza indica BGIOSGA014650 I 0.427
BGIOSGA013223 Oryza indica BGIOSGA013223 I 0.427
YAB3 Arabidopsis thaliana AT4G00180 I 0.427
Bra031629 Brassica rapa Bra031629 I 0.427
Bra037320 Brassica rapa Bra037320 I 0.427
GLYMA06G46560 Glycine max GLYMA06G46560 I 0.427
GLYMA05G04260 Glycine max GLYMA05G04260 I 0.427
GLYMA03G03500 Glycine max GLYMA03G03500 I 0.427
GLYMA01G33370 Glycine max GLYMA01G33370 I 0.427
GLYMA12G10210 Glycine max GLYMA12G10210 I 0.427
GLYMA12G31670 Glycine max GLYMA12G31670 I 0.427
GLYMA17G14710 Glycine max GLYMA17G14710 I 0.427
GLYMA17G12200 Glycine max GLYMA17G12200 I 0.427
GLYMA13G38750 Glycine max GLYMA13G38750 I 0.427
GLYMA13G22620 Glycine max GLYMA13G22620 I 0.427
YAB3 Arabidopsis lyrata fgenesh2_kg.6__3684__AT4G00180.1 I 0.427
YAB5 Arabidopsis lyrata fgenesh2_kg.4__584__AT2G26580.2 I 0.427
BRADI3G50050 Brachypodium distachyon BRADI3G50050 I 0.427
BRADI3G30410 Brachypodium distachyon BRADI3G30410 I 0.427
BRADI1G13570 Brachypodium distachyon BRADI1G13570 I 0.427
Bra040322 Brassica rapa Bra040322 I 0.427
BRADI4G01300 Brachypodium distachyon BRADI4G01300 I 0.427
BRADI5G16910 Brachypodium distachyon BRADI5G16910 I 0.427
YAB2 Arabidopsis lyrata fgenesh2_kg.1__861__AT1G08465.1 I 0.427
F775_28710 Aegilops tauschii F775_28710 I 0.427
F775_27799 Aegilops tauschii F775_27799 I 0.427
F775_25525 Aegilops tauschii F775_25525 I 0.427
OLONG_018568 Oryza longistaminata OLONG_018568 I 0.427
OGLUM02G26190 Oryza glumaepatula OGLUM02G26190 I 0.427
Sb01g013270 Sorghum bicolor Sb01g013270 I 0.427
PRUPE_ppa012028mg Prunus persica PRUPE_ppa012028mg I 0.427
PRUPE_ppa011880m2g Prunus persica PRUPE_ppa011880m2g I 0.427
PRUPE_ppa011209mg Prunus persica PRUPE_ppa011209mg I 0.427
Sb01g017560 Sorghum bicolor Sb01g017560 I 0.427
Sb02g003390 Sorghum bicolor Sb02g003390 I 0.427
AFO Arabidopsis lyrata scaffold_403460.1 I 0.427
Sb08g022030 Sorghum bicolor Sb08g022030 I 0.427
Sb06g023770 Sorghum bicolor Sb06g023770 I 0.427
Sb04g033590 Sorghum bicolor Sb04g033590 I 0.427
PRUPE_ppa010905mg Prunus persica PRUPE_ppa010905mg I 0.427
POPTR_0018s12990 Populus trichocarpa POPTR_0018s12990 I 0.427
YAB2 Populus trichocarpa POPTR_0001s22180 I 0.427
POPTR_0001s00240 Populus trichocarpa POPTR_0001s00240 I 0.427
PGSC0003DMG400030904 Solanum tuberosum PGSC0003DMG400030904 I 0.427
PGSC0003DMG400025969 Solanum tuberosum PGSC0003DMG400025969 I 0.427
POPTR_0002s14600 Populus trichocarpa POPTR_0002s14600 I 0.427
POPTR_0003s11230 Populus trichocarpa POPTR_0003s11230 I 0.427
POPTR_0016s06760 Populus trichocarpa POPTR_0016s06760 I 0.427
POPTR_0014s06210 Populus trichocarpa POPTR_0014s06210 I 0.427
OLONG_018621 Oryza longistaminata OLONG_018621 I 0.427
Si010859m.g Setaria italica Si010859m.g I 0.427
Si018146m.g Setaria italica Si018146m.g I 0.427
Traes_2AL_71DE02042 Triticum aestivum Traes_2AL_71DE02042 I 0.427
Traes_1DL_C5AF9D06A Triticum aestivum Traes_1DL_C5AF9D06A I 0.427
TCM_041175 Theobroma cacao TCM_041175 I 0.427
TCM_038105 Theobroma cacao TCM_038105 I 0.427
Traes_2BL_8BEA9CE1B Triticum aestivum Traes_2BL_8BEA9CE1B I 0.427
Traes_5AL_EB97D69D7 Triticum aestivum Traes_5AL_EB97D69D7 I 0.427
Traes_5DL_0E369E1FC Triticum aestivum Traes_5DL_0E369E1FC I 0.427
Traes_5BS_A782F7510 Triticum aestivum Traes_5BS_A782F7510 I 0.427
Traes_5BL_4DEC298F9 Triticum aestivum Traes_5BL_4DEC298F9 I 0.427
Traes_5AS_31C2540C0 Triticum aestivum Traes_5AS_31C2540C0 I 0.427
TCM_016030 Theobroma cacao TCM_016030 I 0.427
TCM_005549 Theobroma cacao TCM_005549 I 0.427
Si037789m.g Setaria italica Si037789m.g I 0.427
Si036788m.g Setaria italica Si036788m.g I 0.427
Si030811m.g Setaria italica Si030811m.g I 0.427
Si023308m.g Setaria italica Si023308m.g I 0.427
Solyc06g073920.2 Solanum lycopersicum Solyc06g073920.2 I 0.427
Solyc07g008180.2 Solanum lycopersicum Solyc07g008180.2 I 0.427
Solyc12g009580.1 Solanum lycopersicum Solyc12g009580.1 I 0.427
Solyc11g071810.1 Solanum lycopersicum Solyc11g071810.1 I 0.427
Solyc08g079100.2 Solanum lycopersicum Solyc08g079100.2 I 0.427
PGSC0003DMG400005936 Solanum tuberosum PGSC0003DMG400005936 I 0.427
POPTR_0006s06700 Populus trichocarpa POPTR_0006s06700 I 0.427
ORGLA02G0220100 Oryza glaberrima ORGLA02G0220100 I 0.427
OPUNC12G17340 Oryza punctata OPUNC12G17340 I 0.427
OPUNC10G13730 Oryza punctata OPUNC10G13730 I 0.427
OPUNC07G03670 Oryza punctata OPUNC07G03670 I 0.427
ORGLA04G0171000 Oryza glaberrima ORGLA04G0171000 I 0.427
PGSC0003DMG400004741 Solanum tuberosum PGSC0003DMG400004741 I 0.427
ORUFI07G03450 Oryza rufipogon ORUFI07G03450 I 0.427
ORUFI04G21570 Oryza rufipogon ORUFI04G21570 I 0.427
ORUFI03G28820 Oryza rufipogon ORUFI03G28820 I 0.427
ORUFI02G27080 Oryza rufipogon ORUFI02G27080 I 0.427
OPUNC03G25290 Oryza punctata OPUNC03G25290 I 0.427
OPUNC02G23520 Oryza punctata OPUNC02G23520 I 0.427
OMERI10G11950 Oryza meridionalis OMERI10G11950 I 0.427
OMERI07G02330 Oryza meridionalis OMERI07G02330 I 0.427
OMERI04G17000 Oryza meridionalis OMERI04G17000 I 0.427
OMERI02G25190 Oryza meridionalis OMERI02G25190 I 0.427
OMERI12G13460 Oryza meridionalis OMERI12G13460 I 0.427
ONIVA02G03100 Oryza nivara ONIVA02G03100 I 0.427
ONIVA04G21490 Oryza nivara ONIVA04G21490 I 0.427
ONIVA04G18220 Oryza nivara ONIVA04G18220 I 0.427
ONIVA03G28660 Oryza nivara ONIVA03G28660 I 0.427
ONIVA02G28110 Oryza nivara ONIVA02G28110 I 0.427
ORUFI10G16240 Oryza rufipogon ORUFI10G16240 I 0.427
ORGLA12G0165000 Oryza glaberrima ORGLA12G0165000 I 0.427
YAB1 Oryza sativa OS07G0160100 I 0.427
YAB5 Oryza sativa OS04G0536300 I 0.427
YAB2 Oryza sativa OS03G0650000 I 0.427
YAB3 Oryza sativa OS10G0508300 I 0.427
YAB6 Oryza sativa OS12G0621100 I 0.427
PGSC0003DMG400002988 Solanum tuberosum PGSC0003DMG400002988 I 0.427
PGSC0003DMG400002883 Solanum tuberosum PGSC0003DMG400002883 I 0.427
ORUFI12G21410 Oryza rufipogon ORUFI12G21410 I 0.427
YAB4 Oryza sativa OS02G0643200 I 0.427
cassava39135.m1 Manihot esculenta cassava39135.m1 I 0.426
mgf001016m Mimulus guttatus mgf001016m I 0.426
CRC Vitis vinifera VIT_01s0011g00140 I 0.426
GLYMA01G08030 Glycine max GLYMA01G08030 I 0.426
Carubv10021641m.g Capsella rubella Carubv10021641m.g I 0.426
TCM_011484 Theobroma cacao TCM_011484 I 0.426
mgf007067m Mimulus guttatus mgf007067m I 0.426
Lus10036811.g Linum usitatissimum Lus10036811.g I 0.426
Thhalv10019126m.g Eutrema salsugineum Thhalv10019126m.g I 0.426
AMTR_s00047p00199030 Amborella trichopoda AMTR_s00047p00199030 I 0.426
Cucsa.284430 Cucumis sativus Cucsa.284430 I 0.426
evm.TU.contig_30608 Carica papaya evm.TU.contig_30608 I 0.426
Eucgr.B03140 Eucalyptus grandis Eucgr.B03140 I 0.426
CRC Arabidopsis thaliana AT1G69180 D 0.426
Pm030598 Prunus mume Pm030598 I 0.426
PRUPE_ppa014900mg Prunus persica PRUPE_ppa014900mg I 0.426
Bostr.10273s0455 Boechera stricta Bostr.10273s0455 I 0.426
Cagra.0537s0004 Capsella grandiflora Cagra.0537s0004 I 0.426
MDP0000124879 Malus domestica MDP0000124879 I 0.426
cassava10710.m1 Manihot esculenta cassava10710.m1 I 0.426
Cla010397 Citrullus lanatus Cla010397 I 0.426
PK13838.1 Cannabis sativa PK13838.1 I 0.426
30174.m009083 Ricinus communis 30174.m009083 I 0.426
Ca_18533 Cicer arietinum Ca_18533 I 0.426
Bra004364 Brassica rapa Bra004364 I 0.426
MDP0000291729 Malus domestica MDP0000291729 I 0.426
Bo6g108630 Brassica oleracea Bo6g108630 I 0.426
GLYMA02G13350 Glycine max GLYMA02G13350 I 0.426
CRC Arabidopsis lyrata fgenesh2_kg.2__1172__AT1G69180.1 I 0.426
Ca_12379 Cicer arietinum Ca_12379 I 0.426
Gorai.005G146700 Gossypium raimondii Gorai.005G146700 I 0.426
MDP0000171878 Malus domestica MDP0000171878 I 0.426
TCM_031868 Theobroma cacao TCM_031868 I 0.420
Pm006709 Prunus mume Pm006709 I 0.420
GLYMA18G19720 Glycine max GLYMA18G19720 I 0.420
SapurV1A.0269s0230 Salix purpurea SapurV1A.0269s0230 I 0.420
INO Vitis vinifera VIT_01s0127g00330 I 0.420
POPTR_0010s16410 Populus trichocarpa POPTR_0010s16410 I 0.420
PRUPE_ppa023883mg Prunus persica PRUPE_ppa023883mg I 0.420
GLYMA08G39290 Glycine max GLYMA08G39290 I 0.420
GLYMA04G10125 Glycine max GLYMA04G10125 I 0.420
SapurV1A.0069s0070 Salix purpurea SapurV1A.0069s0070 I 0.420
SapurV1A.0072s0330 Salix purpurea SapurV1A.0072s0330 I 0.420
Lus10029135.g Linum usitatissimum Lus10029135.g I 0.420
Lus10013028.g Linum usitatissimum Lus10013028.g I 0.420
Gorai.002G054200 Gossypium raimondii Gorai.002G054200 I 0.420
Gorai.009G367100 Gossypium raimondii Gorai.009G367100 I 0.420
POPTR_0010s05220 Populus trichocarpa POPTR_0010s05220 I 0.420
CMU_009510 Cryptosporidium muris CMU_009510 N 0.418
Cagra.0605s0067 Capsella grandiflora Cagra.0605s0067 I 0.416
Carubv10012024m.g Capsella rubella Carubv10012024m.g I 0.416
BRADI1G57070 Brachypodium distachyon BRADI1G57070 I 0.416
cassava26804.m1 Manihot esculenta cassava26804.m1 I 0.416
GSMUA_Achr3G15060_001 Musa acuminata GSMUA_Achr3G15060_001 I 0.416
GSMUA_Achr8G26600_001 Musa acuminata GSMUA_Achr8G26600_001 I 0.416
GSMUA_Achr8G04750_001 Musa acuminata GSMUA_Achr8G04750_001 I 0.416
GSMUA_AchrUn_randomG19410_001 Musa acuminata GSMUA_AchrUn_randomG19410_001 I 0.416