SapurV1A.0269s0230 (Salix purpurea)
Sox

TF Information

Pfam ID Interpro ID Gene ID CIS-BP ID Sequence source
PF00505 (HMG_box) IPR000910 SapurV1A.0269s0230 T334706_2.00 JGI:Phytozome (2018-Apr-12)

Directly determined binding motifs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
No direct experiments

Motifs from related TFs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
INO
M02485_2.00
Arabidopsis thaliana
NHNNNYRNNN

NNNYRNNNDN
PBM
Weirauch et al.(2014)
pTH7516
0.693 0.844
YAB5
M02486_2.00
Arabidopsis thaliana
NNNNHRN

NYDNNNN
PBM
Weirauch et al.(2014)
pTH7575
0.640 0.733
YAB5
M00889_2.00
Arabidopsis thaliana
NATRATTADNNN

NNNHTAATYATN
PBM
Franco-Zorrilla et al.(2014)
YAB5
0.640 0.733
YAB1
M00890_2.00
Arabidopsis thaliana
AATAATWA

TWATTATT
PBM
Franco-Zorrilla et al.(2014)
YAB1
0.640 0.711
CRC
M07266_2.00
Arabidopsis thaliana
TWATCATW

WATGATWA
Dap-seq
OMalley et al.(2016)
CRC_col_a
0.604 0.578
CRC
M07267_2.00
Arabidopsis thaliana
GGTTAGTGTTTTGGAGTCGAATATGACTTG

CAAGTCATATTCGACTCCAAAACACTAACC
Dap-seq
OMalley et al.(2016)
CRC_colamp_a
0.604 0.578
For this family, TFs with SR scores > 0.415 will likely have a similar motif

DNA Binding Domains

Protein ID Domain From To Sequence
SapurV1A.0269s0230.1.p Sox 123 168
SapurV1A.0269s0230.2.p Sox 123 167
SapurV1A.0269s0230.3.p Sox 123 168
SapurV1A.0269s0230.4.p Sox 123 167

Links

Other Sox family TFs
Other Salix purpurea TFs

Invalid Input OrderBy

534 Related TFs

Name Species Gene ID Motif Evidence SR
Score
Action