SRS7 (Arabidopsis thaliana)
Unknown

TF Information

Pfam ID Interpro ID Gene ID CIS-BP ID Sequence source Animal TF db
Unknown Unknown AT1G19790 T350170_2.00 Ensembl (2018-Dec-8) Link out
NCBI Gene Info:
A member of SHI gene family. Arabidopsis thaliana has ten members that encode proteins with a RING finger-like zinc finger motif. Despite being highly divergent in sequence, many of the SHI-related genes are partially redundant in function and synergistically promote gynoecium, stamen and leaf development in Arabidopsis. Expressed in lateral root primordia and induced by auxin. SWP1 is involved in the repression of LRP1 via histone deacetylation.

Directly determined binding motifs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
SRS7
M07306_2.00
Arabidopsis thaliana
TTAGGGTTTAGGGTTTAGGGTTT

AAACCCTAAACCCTAAACCCTAA
Dap-seq
OMalley et al.(2016)
SRS7_col_a
(Direct) (Direct)
SRS7
M07307_2.00
Arabidopsis thaliana
GRTTTAGGGTTTAGGGTTTAGGGTTTAGGG

CCCTAAACCCTAAACCCTAAACCCTAAAYC
Dap-seq
OMalley et al.(2016)
SRS7_colamp_a
(Direct) (Direct)

Motifs from related TFs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
For this family, TFs with SR scores > 0.700 will likely have a similar motif

DNA Binding Domains

Protein ID Domain From To Sequence
AT1G19790.2 Unknown 1 345

Links

Other Unknown family TFs
Other Arabidopsis thaliana TFs

0 Related TFs

">No related TF found