BGIOSGA012326 (Oryza indica)
Myb/SANT

TF Information

Pfam ID Interpro ID Gene ID CIS-BP ID Sequence source Animal TF db
PF00249 (Myb_DNA-binding) IPR014778 BGIOSGA012326 T266811_2.00 Ensembl (2018-Dec-8) Link out

Directly determined binding motifs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
No direct experiments

Motifs from related TFs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
PK21687.1
M01282_2.00
Cannabis sativa
HWAAACCYH

DRGGTTTWD
PBM
Lambert et al.(2019)
pTH11299
0.909 0.957
TRP2
M07092_2.00
Arabidopsis thaliana
AAACCCTAAACCCTAAACCC

GGGTTTAGGGTTTAGGGTTT
Dap-seq
OMalley et al.(2016)
TRP2_col_a
0.901 0.936
TRP2
M07093_2.00
Arabidopsis thaliana
AAACCCTAAACCCTAAACCCT

AGGGTTTAGGGTTTAGGGTTT
Dap-seq
OMalley et al.(2016)
TRP2_colamp_a
0.901 0.936
TRP1
M07148_2.00
Arabidopsis thaliana
AAACCCTAAACCCTAAACCCTAA

TTAGGGTTTAGGGTTTAGGGTTT
Dap-seq
OMalley et al.(2016)
TRP1_col
0.891 0.957
TRP5
M01266_2.00
Arabidopsis thaliana
NHWAAACCYH

DRGGTTTWDN
PBM
Lambert et al.(2019)
pTH9963
0.849 0.957
For this family, TFs with SR scores > 0.661 will likely have a similar motif

DNA Binding Domains

Protein ID Domain From To Sequence
BGIOSGA012326-PA Myb 646 696

Links

Other Myb/SANT family TFs
Other Oryza indica TFs

197 Related TFs

Name Species Gene ID Motif Evidence SR
Score
Action
ACAC_0000944601 Angiostrongylus cantonensis ACAC_0000944601 N 0.000
NECAME_05105 Necator americanus NECAME_05105 N 0.000
NBR_0000626701 Nippostrongylus brasiliensis NBR_0000626701 N 0.000
HPBE_0000939901 Heligmosomoides bakeri HPBE_0000939901 N 0.000
HCOI00234300 Haemonchus contortus HCOI00234300 N 0.000
Hba_21573 Heterorhabditis bacteriophora Hba_21573 N 0.000
DICVIV_11917 Dictyocaulus viviparus DICVIV_11917 N 0.000
ANCCEY_10965 Ancylostoma ceylanicum ANCCEY_10965 N 0.000
ANCCAN_11079 Ancylostoma caninum ANCCAN_11079 N 0.000
ANCCAN_09721 Ancylostoma caninum ANCCAN_09721 N 0.000
ACOC_0000427301 Angiostrongylus costaricensis ACOC_0000427301 N 0.000
TELCIR_04506 Teladorsagia circumcincta TELCIR_04506 N 0.000