MTR_2g097290 (Medicago truncatula)
Myb/SANT

TF Information

Pfam ID Interpro ID Gene ID CIS-BP ID Sequence source Animal TF db
PF00249 (Myb_DNA-binding) IPR014778 MTR_2g097290 T274747_2.00 Ensembl (2018-Dec-8) Link out

Directly determined binding motifs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
No direct experiments

Motifs from related TFs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
TRP5
M01266_2.00
Arabidopsis thaliana
NHWAAACCYH

DRGGTTTWDN
PBM
Lambert et al.(2019)
pTH9963
0.891 0.957
TRP1
M07148_2.00
Arabidopsis thaliana
AAACCCTAAACCCTAAACCCTAA

TTAGGGTTTAGGGTTTAGGGTTT
Dap-seq
OMalley et al.(2016)
TRP1_col
0.831 0.936
PK21687.1
M01282_2.00
Cannabis sativa
HWAAACCYH

DRGGTTTWD
PBM
Lambert et al.(2019)
pTH11299
0.831 0.915
TRP2
M07092_2.00
Arabidopsis thaliana
AAACCCTAAACCCTAAACCC

GGGTTTAGGGTTTAGGGTTT
Dap-seq
OMalley et al.(2016)
TRP2_col_a
0.823 0.894
TRP2
M07093_2.00
Arabidopsis thaliana
AAACCCTAAACCCTAAACCCT

AGGGTTTAGGGTTTAGGGTTT
Dap-seq
OMalley et al.(2016)
TRP2_colamp_a
0.823 0.894
For this family, TFs with SR scores > 0.661 will likely have a similar motif

DNA Binding Domains

Protein ID Domain From To Sequence
AES67615 Myb 626 676

Links

Other Myb/SANT family TFs
Other Medicago truncatula TFs

197 Related TFs

Name Species Gene ID Motif Evidence SR
Score
Action
ACYPI001768 Acyrthosiphon pisum ACYPI001768 I 0.000
AAEL017515 Aedes aegypti AAEL017515 I 0.000
ENSAMEG00000015152 Ailuropoda melanoleuca ENSAMEG00000015152 I 0.000
ENSAMEG00000007902 Ailuropoda melanoleuca ENSAMEG00000007902 I 0.000
ENSAMEG00000002278 Ailuropoda melanoleuca ENSAMEG00000002278 I 0.000
Alligator_sinensis_CCG017770.1 Alligator sinensis Alligator_sinensis_CCG017770.1 I 0.000
Alligator_sinensis_CCG003733.1 Alligator sinensis Alligator_sinensis_CCG003733.1 I 0.000
Alligator_sinensis_CCG003546.1 Alligator sinensis Alligator_sinensis_CCG003546.1 I 0.000
Aqu1.229614 Amphimedon queenslandica Aqu1.229614 I 0.000
ENSAPLG00000006786 Anas platyrhynchos ENSAPLG00000006786 I 0.000
ENSAPLG00000013843 Anas platyrhynchos ENSAPLG00000013843 I 0.000
ENSAPLG00000012521 Anas platyrhynchos ENSAPLG00000012521 I 0.000
ANCCEY_09873 Ancylostoma ceylanicum ANCCEY_09873 I 0.000
ANCDUO_03634 Ancylostoma duodenale ANCDUO_03634 I 0.000
ACAC_0001135701 Angiostrongylus cantonensis ACAC_0001135701 I 0.000
ACOC_0000083501 Angiostrongylus costaricensis ACOC_0000083501 I 0.000
ASIM_0001595001 Anisakis simplex ASIM_0001595001 I 0.000
CREM Anolis carolinensis ENSACAG00000000947 I 0.000
ATF1 Anolis carolinensis ENSACAG00000017202 I 0.000
AALB006516 Anopheles albimanus AALB006516 I 0.000
AARA010573 Anopheles arabiensis AARA010573 I 0.000
AATE001768 Anopheles atroparvus AATE001768 I 0.000
ACUA025670 Anopheles culicifacies ACUA025670 I 0.000
ADAC001181 Anopheles darlingi ADAC001181 I 0.000
ADIR001263 Anopheles dirus ADIR001263 I 0.000
AEPI009411 Anopheles epiroticus AEPI009411 I 0.000
AFAF009456 Anopheles farauti AFAF009456 I 0.000
AGAP000237 Anopheles gambiae AGAP000237 I 0.000
AMEM004122 Anopheles merus AMEM004122 I 0.000
AMIN005513 Anopheles minimus AMIN005513 I 0.000
ASTEI01101 Anopheles stephensi ASTEI01101 I 0.000
GB46492 Apis mellifera GB46492 I 0.000
Afo_R013281 Aptenodytes forsteri Afo_R013281 I 0.000
Afo_R006974 Aptenodytes forsteri Afo_R006974 I 0.000
Afo_R004077 Aptenodytes forsteri Afo_R004077 I 0.000
ALUE_0001453301 Ascaris lumbricoides ALUE_0001453301 I 0.000
ASU_12457 Ascaris suum ASU_12457 I 0.000
ENSAMXG00000012403 Astyanax mexicanus ENSAMXG00000012403 I 0.000
ENSAMXG00000024514 Astyanax mexicanus ENSAMXG00000024514 I 0.000
ENSAMXG00000000111 Astyanax mexicanus ENSAMXG00000000111 I 0.000
ENSAMXG00000001501 Astyanax mexicanus ENSAMXG00000001501 I 0.000
ENSAMXG00000015423 Astyanax mexicanus ENSAMXG00000015423 I 0.000
ACEP12908 Atta cephalotes ACEP12908 I 0.000
BGIBMGA006865 Bombyx mori BGIBMGA006865 I 0.000
ENSP00000262053-D1 Bos grunniens ENSP00000262053-D1 I 0.000
ENSP00000393538-D1 Bos grunniens ENSP00000393538-D1 I 0.000
ENSBTAP00000007199-D1 Bos grunniens ENSBTAP00000007199-D1 I 0.000
CREM Bos taurus ENSBTAG00000016060 I 0.000
ATF1 Bos taurus ENSBTAG00000018131 I 0.000
CREB1 Bos taurus ENSBTAG00000005474 I 0.000
estExt_fgenesh2_pg.C_1890007 Branchiostoma floridae estExt_fgenesh2_pg.C_1890007 I 0.000
fgenesh2_pm.scaffold_206000011 Branchiostoma floridae fgenesh2_pm.scaffold_206000011 I 0.000
Bm6510 Brugia malayi Bm6510 I 0.000
BTMF_0001407201 Brugia timori BTMF_0001407201 I 0.000
Brh_R007085 Buceros rhinoceros Brh_R007085 I 0.000
Brh_R003804 Buceros rhinoceros Brh_R003804 I 0.000
Brh_R004891 Buceros rhinoceros Brh_R004891 I 0.000
BXY_1632500 Bursaphelenchus xylophilus BXY_1632500 I 0.000
CBN14993 Caenorhabditis brenneri CBN14993 I 0.000
CBG13248 Caenorhabditis briggsae CBG13248 I 0.000
crh-1 Caenorhabditis elegans WBGene00000793 I 0.000
CJA03750 Caenorhabditis japonica CJA03750 I 0.000
CRE01024 Caenorhabditis remanei CRE01024 I 0.000
CREM Callithrix jacchus ENSCJAG00000014066 I 0.000
CREB1 Callithrix jacchus ENSCJAG00000006039 I 0.000
ATF1 Callithrix jacchus ENSCJAG00000021155 I 0.000
Aan_R013671 Calypte anna Aan_R013671 I 0.000
Aan_R009562 Calypte anna Aan_R009562 I 0.000
Aan_R006726 Calypte anna Aan_R006726 I 0.000
Cflo_01773--XP_392916.2_APIME Camponotus floridanus Cflo_01773--XP_392916.2_APIME I 0.000
ATF1 Canis familiaris ENSCAFG00000007928 I 0.000
CREM Canis familiaris ENSCAFG00000003685 I 0.000
CREB1 Canis familiaris ENSCAFG00000013510 I 0.000
CAOG_04938 Capsaspora owczarzaki CAOG_04938 I 0.000
CREM Cavia porcellus ENSCPOG00000015442 I 0.000
CREB1 Cavia porcellus ENSCPOG00000010778 I 0.000
ENSCPOG00000000129 Cavia porcellus ENSCPOG00000000129 I 0.000
Cmyd_10008405 Chelonia mydas Cmyd_10008405 I 0.000
Cmyd_10006103 Chelonia mydas Cmyd_10006103 I 0.000
ENSCSAG00000011357 Chlorocebus sabaeus ENSCSAG00000011357 I 0.000
ENSCSAG00000005951 Chlorocebus sabaeus ENSCSAG00000005951 I 0.000
ENSCSAG00000010111 Chlorocebus sabaeus ENSCSAG00000010111 I 0.000
CREB1 Choloepus hoffmanni ENSCHOG00000001783 I 0.000
ATF1 Choloepus hoffmanni ENSCHOG00000004733 I 0.000
ENSCHOG00000006035 Choloepus hoffmanni ENSCHOG00000006035 I 0.000
CLEC000699 Cimex lectularius CLEC000699 I 0.000
ENSCING00000004753 Ciona intestinalis ENSCING00000004753 I 0.000
ENSCSAVG00000005696 Ciona savignyi ENSCSAVG00000005696 I 0.000
csin107912 Clonorchis sinensis csin107912 I 0.000
CGI_10022186 Crassostrea gigas CGI_10022186 I 0.000
CGI_10022187 Crassostrea gigas CGI_10022187 I 0.000
CpipJ_CPIJ003805 Culex pipiens CpipJ_CPIJ003805 I 0.000
CPIJ003805 Culex quinquefasciatus CPIJ003805 I 0.000
KGM_11157 Danaus plexippus KGM_11157 I 0.000
crema Danio rerio ENSDARG00000023217 I 0.000
creb1b Danio rerio ENSDARG00000093420 I 0.000
cremb Danio rerio ENSDARG00000102899 I 0.000
creb1a Danio rerio ENSDARG00000053586 I 0.000
atf1 Danio rerio ENSDARG00000044301 I 0.000
DAPPUDRAFT_330320 Daphnia pulex DAPPUDRAFT_330320 I 0.000
ATF1 Dasypus novemcinctus ENSDNOG00000006951 I 0.000
CREM Dasypus novemcinctus ENSDNOG00000000427 I 0.000
CREB1 Dasypus novemcinctus ENSDNOG00000008373 I 0.000
YQE_07616 Dendroctonus ponderosae YQE_07616 I 0.000
DICVIV_01216 Dictyocaulus viviparus DICVIV_01216 I 0.000
Creb1 Dipodomys ordii ENSDORG00000012535 I 0.000
nDi.2.2.2.g05770 Dirofilaria immitis nDi.2.2.2.g05770 I 0.000
DME_0000992301 Dracunculus medinensis DME_0000992301 I 0.000
GF22432 Drosophila ananassae FBgn0099428 I 0.000
GG19161 Drosophila erecta FBgn0111367 I 0.000
GH17726 Drosophila grimshawi FBgn0125196 I 0.000
CrebB-17A Drosophila melanogaster FBgn0265784 D 0.000
GI15475 Drosophila mojavensis FBgn0138224 I 0.000
GL26969 Drosophila persimilis FBgn0164550 I 0.000
GA22328 Drosophila pseudoobscura FBgn0243735 I 0.000
GM22894 Drosophila sechellia FBgn0177763 I 0.000
GD17392 Drosophila simulans FBgn0188949 I 0.000
GK20005 Drosophila willistoni FBgn0222002 I 0.000
GE17723 Drosophila yakuba FBgn0235170 I 0.000
ECANG7_02913 Echinococcus canadensis ECANG7_02913 I 0.000
EmuJ_000908300 Echinococcus multilocularis EmuJ_000908300 I 0.000
CREM Echinops telfairi ENSETEG00000004357 I 0.000
EVEC_0001300501 Enterobius vermicularis EVEC_0001300501 I 0.000
CREB1 Equus caballus ENSECAG00000013667 I 0.000
ATF1 Equus caballus ENSECAG00000016445 I 0.000
CREM Equus caballus ENSECAG00000011220 I 0.000
CREM Erinaceus europaeus ENSEEUG00000003158 I 0.000
CREB1 Erinaceus europaeus ENSEEUG00000014506 I 0.000
ATF1 Erinaceus europaeus ENSEEUG00000008000 I 0.000
D915_04082 Fasciola hepatica D915_04082 I 0.000
CREM Felis catus ENSFCAG00000006017 I 0.000
CREB1 Felis catus ENSFCAG00000008220 I 0.000
ATF1 Felis catus ENSFCAG00000013892 I 0.000
ENSFALG00000003996 Ficedula albicollis ENSFALG00000003996 I 0.000
ENSFALG00000002102 Ficedula albicollis ENSFALG00000002102 I 0.000
ENSFALG00000007036 Ficedula albicollis ENSFALG00000007036 I 0.000
NechaG83404 Fusarium solani NechaG83404 I 0.000
ENSGMOG00000002707 Gadus morhua ENSGMOG00000002707 I 0.000
ENSGMOG00000017705 Gadus morhua ENSGMOG00000017705 I 0.000
ENSGALG00000006089 Gallus gallus ENSGALG00000006089 I 0.000
CREM Gallus gallus ENSGALG00000007082 I 0.000
ENSGALG00000008494 Gallus gallus ENSGALG00000008494 I 0.000
creb1a Gasterosteus aculeatus ENSGACG00000014712 I 0.000
atf1 Gasterosteus aculeatus ENSGACG00000000667 I 0.000
Gfo_R013116 Geospiza fortis Gfo_R013116 I 0.000
Gfo_R001453 Geospiza fortis Gfo_R001453 I 0.000
Gfo_R014381 Geospiza fortis Gfo_R014381 I 0.000
GPUH_0000647401 Gongylonema pulchrum GPUH_0000647401 I 0.000
CREB1 Gorilla gorilla ENSGGOG00000024394 I 0.000
CREM Gorilla gorilla ENSGGOG00000003999 I 0.000
HCOI01263100 Haemonchus contortus HCOI01263100 I 0.000
HCOI00416900 Haemonchus contortus HCOI00416900 I 0.000
HPLM_0001573301 Haemonchus placei HPLM_0001573301 I 0.000
Hsal_12043--XP_392916.2_APIME Harpegnathos saltator Hsal_12043--XP_392916.2_APIME I 0.000
HMEL012108 Heliconius melpomene HMEL012108 I 0.000
HelroG70260 Helobdella robusta HelroG70260 I 0.000
HelroG153829 Helobdella robusta HelroG153829 I 0.000
CREB1 Homo sapiens ENSG00000118260 D 0.000
CREM Homo sapiens ENSG00000095794 D 0.000
ATF1 Homo sapiens ENSG00000123268 D 0.000
XP_002162729.1 Hydra magnipapillata XP_002162729.1 I 0.000
HmN_000890700 Hymenolepis microstoma HmN_000890700 I 0.000
HNAJ_0001178801 Hymenolepis nana HNAJ_0001178801 I 0.000
ENSSTOG00000005403 Ictidomys tridecemlineatus ENSSTOG00000005403 I 0.000
ENSSTOG00000010742 Ictidomys tridecemlineatus ENSSTOG00000010742 I 0.000
ISCW012507 Ixodes scapularis ISCW012507 I 0.000
ENSLACG00000009100 Latimeria chalumnae ENSLACG00000009100 I 0.000
ENSLACG00000015946 Latimeria chalumnae ENSLACG00000015946 I 0.000
ENSLACG00000018861 Latimeria chalumnae ENSLACG00000018861 I 0.000
ENSLOCG00000004320 Lepisosteus oculatus ENSLOCG00000004320 I 0.000
ENSLOCG00000000580 Lepisosteus oculatus ENSLOCG00000000580 I 0.000
ENSLOCG00000006826 Lepisosteus oculatus ENSLOCG00000006826 I 0.000
LDEC007489 Leptinotarsa decemlineata LDEC007489 I 0.000
nLs.2.1.2.g00918 Litomosoides sigmodontis nLs.2.1.2.g00918 I 0.000
LOAG_06769 Loa loa LOAG_06769 I 0.000
LotgiG135093 Lottia gigantea LotgiG135093 I 0.000
ATF1 Loxodonta africana ENSLAFG00000026957 I 0.000
CREB1 Loxodonta africana ENSLAFG00000013257 I 0.000
CREM Loxodonta africana ENSLAFG00000000007 I 0.000
ENSLAFG00000000441 Loxodonta africana ENSLAFG00000000441 I 0.000
LCUP018087 Lucilia cuprina LCUP018087 I 0.000
ENSP00000262053 Macaca fascicularis ENSP00000262053 I 0.000
ENSP00000387699 Macaca fascicularis ENSP00000387699 I 0.000
ENSP00000379232 Macaca fascicularis ENSP00000379232 I 0.000
CREB1 Macaca mulatta ENSMMUG00000022601 I 0.000
CREM Macaca mulatta ENSMMUG00000022508 I 0.000
ENSMMUG00000012095 Macaca mulatta ENSMMUG00000012095 I 0.000
ENSMEUG00000007374 Macropus eugenii ENSMEUG00000007374 I 0.000
ENSMEUG00000005351 Macropus eugenii ENSMEUG00000005351 I 0.000
MESCA012340 Megaselia scalaris MESCA012340 I 0.000
CREM Meleagris gallopavo ENSMGAG00000005858 I 0.000
CREB1 Meleagris gallopavo ENSMGAG00000008360 I 0.000
ATF1 Meleagris gallopavo ENSMGAG00000010646 I 0.000
MCINX000363 Melitaea cinxia MCINX000363 I 0.000
Minc09689 Meloidogyne incognita Minc09689 I 0.000
CREM Microcebus murinus ENSMICG00000000835 I 0.000
ATF1 Microcebus murinus ENSMICG00000003301 I 0.000
ML077623a Mnemiopsis leidyi ML077623a I 0.000
CREB1 Monodelphis domestica ENSMODG00000015970 I 0.000
ATF1 Monodelphis domestica ENSMODG00000006303 I 0.000
CREM Monodelphis domestica ENSMODG00000006900 I 0.000
MDOA002611 Musca domestica MDOA002611 I 0.000
ENSMPUG00000005982 Mustela putorius furo ENSMPUG00000005982 I 0.000
ENSMPUG00000005295 Mustela putorius furo ENSMPUG00000005295 I 0.000
ENSMPUG00000000485 Mustela putorius furo ENSMPUG00000000485 I 0.000
Atf1 Mus musculus ENSMUSG00000023027 D 0.000
Creb1 Mus musculus ENSMUSG00000025958 D 0.000
Crem Mus musculus ENSMUSG00000063889 D 0.000
Myotis_brandtii_CREB1_10028379 Myotis brandtii Myotis_brandtii_CREB1_10028379 I 0.000
Myotis_brandtii_ATF1_10023095 Myotis brandtii Myotis_brandtii_ATF1_10023095 I 0.000
Myotis_brandtii_CREM_10006947 Myotis brandtii Myotis_brandtii_CREM_10006947 I 0.000
ENSMLUG00000023181 Myotis lucifugus ENSMLUG00000023181 I 0.000
CREM Myotis lucifugus ENSMLUG00000015031 I 0.000
CREB1 Myotis lucifugus ENSMLUG00000016119 I 0.000
ENSMLUG00000024865 Myotis lucifugus ENSMLUG00000024865 I 0.000
NV12233 Nasonia vitripennis NV12233 I 0.000
NECAME_06452 Necator americanus NECAME_06452 I 0.000
fgenesh1_pg.sca_17_chr8_1_0000177 Nectria haematococca fgenesh1_pg.sca_17_chr8_1_0000177 I 0.000
NEMVEDRAFT_v1g242787 Nematostella vectensis NEMVEDRAFT_v1g242787 I 0.000
NBR_0001433801 Nippostrongylus brasiliensis NBR_0001433801 I 0.000
ENSNLEG00000007124 Nomascus leucogenys ENSNLEG00000007124 I 0.000
ENSNLEG00000017793 Nomascus leucogenys ENSNLEG00000017793 I 0.000
ENSNLEG00000018140 Nomascus leucogenys ENSNLEG00000018140 I 0.000
CREB1 Ochotona princeps ENSOPRG00000002385 I 0.000
Ocbimv22011020m.g Octopus bimaculoides Ocbimv22011020m.g I 0.000
OESDEN_00693 Oesophagostomum dentatum OESDEN_00693 I 0.000
SNAPOd2T00012707001 Oikopleura dioica SNAPOd2T00012707001 I 0.000
SNAPOd2T00016751001 Oikopleura dioica SNAPOd2T00016751001 I 0.000
SNAPOd2T00023549001 Oikopleura dioica SNAPOd2T00023549001 I 0.000
SNAPOd2T00012706001 Oikopleura dioica SNAPOd2T00012706001 I 0.000
nOo.2.0.1.g00916 Onchocerca ochengi nOo.2.0.1.g00916 I 0.000
WBGene00244541 Onchocerca volvulus WBGene00244541 I 0.000
Ogr12055 Ophisaurus gracilis Ogr12055 I 0.000
Ogr06608 Ophisaurus gracilis Ogr06608 I 0.000
T265_03597 Opisthorchis viverrini T265_03597 I 0.000
ENSONIG00000013380 Oreochromis niloticus ENSONIG00000013380 I 0.000
ENSONIG00000017092 Oreochromis niloticus ENSONIG00000017092 I 0.000
ENSONIG00000019133 Oreochromis niloticus ENSONIG00000019133 I 0.000
ENSONIG00000014968 Oreochromis niloticus ENSONIG00000014968 I 0.000
ENSONIG00000003656 Oreochromis niloticus ENSONIG00000003656 I 0.000
ENSOANG00000006077 Ornithorhynchus anatinus ENSOANG00000006077 I 0.000
ATF1 Ornithorhynchus anatinus ENSOANG00000012838 I 0.000
CREB1 Oryctolagus cuniculus ENSOCUG00000005427 I 0.000
ATF1 Oryctolagus cuniculus ENSOCUG00000017023 I 0.000
atf1 Oryzias latipes ENSORLG00000019069 I 0.000
creb1a Oryzias latipes ENSORLG00000002359 I 0.000
CREM Otolemur garnettii ENSOGAG00000013986 I 0.000
ATF1 Otolemur garnettii ENSOGAG00000026029 I 0.000
CREB1 Otolemur garnettii ENSOGAG00000007121 I 0.000
ENSOARG00000018847 Ovis aries ENSOARG00000018847 I 0.000
ENSOARG00000016854 Ovis aries ENSOARG00000016854 I 0.000
ENSOARG00000017519 Ovis aries ENSOARG00000017519 I 0.000
CREB1 Pan troglodytes ENSPTRG00000023623 I 0.000
CREM Pan troglodytes ENSPTRG00000002420 I 0.000
ATF1 Pan troglodytes ENSPTRG00000004941 I 0.000
ENSPANG00000022744 Papio anubis ENSPANG00000022744 I 0.000
ENSPANG00000012542 Papio anubis ENSPANG00000012542 I 0.000
ENSPANG00000009083 Papio anubis ENSPANG00000009083 I 0.000
PEQ_0000081501 Parascaris equorum PEQ_0000081501 I 0.000
PTRK_0000723500 Parastrongyloides trichosuri PTRK_0000723500 I 0.000
PHUM613960 Pediculus humanus PHUM613960 I 0.000
ENSPSIG00000005343 Pelodiscus sinensis ENSPSIG00000005343 I 0.000
ENSPSIG00000015762 Pelodiscus sinensis ENSPSIG00000015762 I 0.000
ENSPSIG00000016772 Pelodiscus sinensis ENSPSIG00000016772 I 0.000
ENSPMAG00000006211 Petromyzon marinus ENSPMAG00000006211 I 0.000
ENSPMAG00000005844 Petromyzon marinus ENSPMAG00000005844 I 0.000
ENSPMAG00000000425 Petromyzon marinus ENSPMAG00000000425 I 0.000
ENSPFOG00000001391 Poecilia formosa ENSPFOG00000001391 I 0.000
ENSPFOG00000015397 Poecilia formosa ENSPFOG00000015397 I 0.000
ENSPFOG00000013920 Poecilia formosa ENSPFOG00000013920 I 0.000
ENSPFOG00000000041 Poecilia formosa ENSPFOG00000000041 I 0.000
ENSPFOG00000008765 Poecilia formosa ENSPFOG00000008765 I 0.000
Pvit_00697 Pogona vitticeps Pvit_00697 I 0.000
Pvit_04090 Pogona vitticeps Pvit_04090 I 0.000
Pvit_13103 Pogona vitticeps Pvit_13103 I 0.000
ENSPPYG00000013115 Pongo abelii ENSPPYG00000013115 I 0.000
ENSPPYG00000002198 Pongo abelii ENSPPYG00000002198 I 0.000
scaffold783-EXSNAP2012.2 Pristionchus exspectatus scaffold783-EXSNAP2012.2 I 0.000
Ppa-crh-1 Pristionchus pacificus PPA24672 I 0.000
ATF1 Procavia capensis ENSPCAG00000010038 I 0.000
CREB1 Procavia capensis ENSPCAG00000007259 I 0.000
CREM Procavia capensis ENSPCAG00000010193 I 0.000
CREM Pteropus vampyrus ENSPVAG00000005072 I 0.000
CREB1 Pteropus vampyrus ENSPVAG00000011019 I 0.000
ATF1 Pteropus vampyrus ENSPVAG00000016113 I 0.000
Atf1 Rattus norvegicus ENSRNOG00000061088 I 0.000
Crem Rattus norvegicus ENSRNOG00000014900 I 0.000
Creb1 Rattus norvegicus ENSRNOG00000013412 I 0.000
RSKR_0000611500 Rhabditophanes kr3021 RSKR_0000611500 I 0.000
RPRC009923 Rhodnius prolixus RPRC009923 I 0.000
Sakowv30003317m.g Saccoglossus kowalevskii Sakowv30003317m.g I 0.000
ENSSHAG00000004637 Sarcophilus harrisii ENSSHAG00000004637 I 0.000
ENSSHAG00000013905 Sarcophilus harrisii ENSSHAG00000013905 I 0.000
ENSSHAG00000017148 Sarcophilus harrisii ENSSHAG00000017148 I 0.000
A_01167 Schistosoma haematobium A_01167 I 0.000
Smp_064010 Schistosoma mansoni Smp_064010 I 0.000
SMRZ_0000380501 Schistosoma margrebowiei SMRZ_0000380501 I 0.000
SMTD_0001957201 Schistosoma mattheei SMTD_0001957201 I 0.000
SMU15003845 Schmidtea mediterranea SMU15003845 I 0.000
SBAD_0000509401 Soboliphyme baturini SBAD_0000509401 I 0.000
SINV25657 Solenopsis invicta SINV25657 I 0.000
CREM Sorex araneus ENSSARG00000005389 I 0.000
CREB1 Sorex araneus ENSSARG00000011010 I 0.000
ATF1 Sorex araneus ENSSARG00000006869 I 0.000
L596_g4732 Steinernema carpocapsae L596_g4732 I 0.000
L889_g12216 Steinernema feltiae L889_g12216 I 0.000
L893_g32939 Steinernema glaseri L893_g32939 I 0.000
L892_g3586 Steinernema scapterisci L892_g3586 I 0.000
SMAR010009 Strigamia maritima SMAR010009 I 0.000
SPU_005358 Strongylocentrotus purpuratus SPU_005358 I 0.000
SPAL_0000284800 Strongyloides papillosus SPAL_0000284800 I 0.000
SSTP_0000333300 Strongyloides stercoralis SSTP_0000333300 I 0.000
SVE_1615800 Strongyloides venezuelensis SVE_1615800 I 0.000
ATF1 Sus scrofa ENSSSCG00000016138 I 0.000
CREM Sus scrofa ENSSSCG00000011106 I 0.000
SMUV_0000993401 Syphacia muris SMUV_0000993401 I 0.000
ATF1 Taeniopygia guttata ENSTGUG00000003395 I 0.000
CREB1 Taeniopygia guttata ENSTGUG00000010023 I 0.000
CREM Taeniopygia guttata ENSTGUG00000000919 I 0.000
creb1b Takifugu rubripes ENSTRUG00000014697 I 0.000
atf1 Takifugu rubripes ENSTRUG00000008032 I 0.000
creb1a Takifugu rubripes ENSTRUG00000007984 I 0.000
ENSTRUG00000004097 Takifugu rubripes ENSTRUG00000004097 I 0.000
ENSTSYG00000012085 Tarsius syrichta ENSTSYG00000012085 I 0.000
ENSTSYG00000006955 Tarsius syrichta ENSTSYG00000006955 I 0.000
ENSTSYG00000014152 Tarsius syrichta ENSTSYG00000014152 I 0.000
TELCIR_06671 Teladorsagia circumcincta TELCIR_06671 I 0.000
tetur08g05060 Tetranychus urticae tetur08g05060 I 0.000
atf1 Tetraodon nigroviridis ENSTNIG00000014568 I 0.000
creb1a Tetraodon nigroviridis ENSTNIG00000008339 I 0.000
creb1a Tetraodon nigroviridis ENSTNIG00000008335 I 0.000
creb1b Tetraodon nigroviridis ENSTNIG00000005543 I 0.000
TCLT_0000992301 Thelazia callipaeda TCLT_0000992301 I 0.000
TCNE_0000150901 Toxocara canis TCNE_0000150901 I 0.000
TC008534 Tribolium castaneum TC008534 I 0.000
TriadG54968 Trichoplax adhaerens TriadG54968 I 0.000
TMUE_s0169000400 Trichuris muris TMUE_s0169000400 I 0.000
D918_01709 Trichuris suis D918_01709 I 0.000
TTRE_0000422601 Trichuris trichiura TTRE_0000422601 I 0.000
CREM Tupaia belangeri ENSTBEG00000004847 I 0.000
ATF1 Tupaia belangeri ENSTBEG00000010876 I 0.000
CREB1 Tupaia belangeri ENSTBEG00000015171 I 0.000
CREB1 Tursiops truncatus ENSTTRG00000015733 I 0.000
CREM Tursiops truncatus ENSTTRG00000012105 I 0.000
Tal_R012497 Tyto alba Tal_R012497 I 0.000
Tal_R012012 Tyto alba Tal_R012012 I 0.000
Tal_R007501 Tyto alba Tal_R007501 I 0.000
ATF1 Vicugna pacos ENSVPAG00000010138 I 0.000
WUBG_10037 Wuchereria bancrofti WUBG_10037 I 0.000
AAH92037 Xenopus laevis AAH92037 I 0.000
creb1.S Xenopus laevis XB-GENE-945020 I 0.000
atf1.L Xenopus laevis XB-GENE-971684 I 0.000
crem Xenopus tropicalis XB-GENE-986312 I 0.000
creb1 Xenopus tropicalis XB-GENE-945015 I 0.000
atf1 Xenopus tropicalis XB-GENE-971677 I 0.000
ENSXMAG00000006361 Xiphophorus maculatus ENSXMAG00000006361 I 0.000
ENSXMAG00000002218 Xiphophorus maculatus ENSXMAG00000002218 I 0.000
ENSXMAG00000008185 Xiphophorus maculatus ENSXMAG00000008185 I 0.000
ENSXMAG00000007848 Xiphophorus maculatus ENSXMAG00000007848 I 0.000
ENSXMAG00000001305 Xiphophorus maculatus ENSXMAG00000001305 I 0.000
L798_07112 Zootermopsis nevadensis L798_07112 I 0.000