Ca_16107 (Cicer arietinum)
Myb/SANT

TF Information

Pfam ID Interpro ID Gene ID CIS-BP ID Sequence source
PF00249 (Myb_DNA-binding) IPR014778 Ca_16107 T283052_2.00 GigaDB (2015-Oct-22)

Directly determined binding motifs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
No direct experiments

Motifs from related TFs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
TRP5
M01266_2.00
Arabidopsis thaliana
NHWAAACCYH

DRGGTTTWDN
PBM
Lambert et al.(2019)
pTH9963
0.839 0.872
PK21687.1
M01282_2.00
Cannabis sativa
HWAAACCYH

DRGGTTTWD
PBM
Lambert et al.(2019)
pTH11299
0.839 0.872
TRP2
M07092_2.00
Arabidopsis thaliana
AAACCCTAAACCCTAAACCC

GGGTTTAGGGTTTAGGGTTT
Dap-seq
OMalley et al.(2016)
TRP2_col_a
0.831 0.851
TRP2
M07093_2.00
Arabidopsis thaliana
AAACCCTAAACCCTAAACCCT

AGGGTTTAGGGTTTAGGGTTT
Dap-seq
OMalley et al.(2016)
TRP2_colamp_a
0.831 0.851
TRP1
M07148_2.00
Arabidopsis thaliana
AAACCCTAAACCCTAAACCCTAA

TTAGGGTTTAGGGTTTAGGGTTT
Dap-seq
OMalley et al.(2016)
TRP1_col
0.821 0.851
For this family, TFs with SR scores > 0.661 will likely have a similar motif

DNA Binding Domains

Protein ID Domain From To Sequence
Ca_16107 Myb 539 589

Links

Other Myb/SANT family TFs
Other Cicer arietinum TFs

197 Related TFs

Name Species Gene ID Motif Evidence SR
Score
Action
27401.m000291 Ricinus communis 27401.m000291 I 0.000
27585.m000144 Ricinus communis 27585.m000144 I 0.000
28049.m000300 Ricinus communis 28049.m000300 I 0.000
28192.m000255 Ricinus communis 28192.m000255 I 0.000
28552.m000029 Ricinus communis 28552.m000029 I 0.000
29584.m000235 Ricinus communis 29584.m000235 I 0.000
29584.m000237 Ricinus communis 29584.m000237 I 0.000
29603.m000509 Ricinus communis 29603.m000509 I 0.000
29603.m000510 Ricinus communis 29603.m000510 I 0.000
29726.m004013 Ricinus communis 29726.m004013 I 0.000
29792.m000600 Ricinus communis 29792.m000600 I 0.000
29895.m000321 Ricinus communis 29895.m000321 I 0.000
29900.m001559 Ricinus communis 29900.m001559 I 0.000
29900.m001561 Ricinus communis 29900.m001561 I 0.000
29983.m003147 Ricinus communis 29983.m003147 I 0.000
29986.m001656 Ricinus communis 29986.m001656 I 0.000
30128.m008571 Ricinus communis 30128.m008571 I 0.000
30131.m006951 Ricinus communis 30131.m006951 I 0.000
30147.m014329 Ricinus communis 30147.m014329 I 0.000
30147.m014331 Ricinus communis 30147.m014331 I 0.000
30190.m011321 Ricinus communis 30190.m011321 I 0.000
AC198979.4_FG009 Zea mays AC198979.4_FG009 I 0.000
AMTR_s00003p00133970 Amborella trichopoda AMTR_s00003p00133970 I 0.000
AMTR_s00003p00135920 Amborella trichopoda AMTR_s00003p00135920 I 0.000
AMTR_s00009p00147970 Amborella trichopoda AMTR_s00009p00147970 I 0.000
AMTR_s00009p00148470 Amborella trichopoda AMTR_s00009p00148470 I 0.000
AMTR_s00010p00098700 Amborella trichopoda AMTR_s00010p00098700 I 0.000
AMTR_s00010p00099690 Amborella trichopoda AMTR_s00010p00099690 I 0.000
AMTR_s00016p00238800 Amborella trichopoda AMTR_s00016p00238800 I 0.000
AMTR_s00021p00184450 Amborella trichopoda AMTR_s00021p00184450 I 0.000
AMTR_s00021p00185480 Amborella trichopoda AMTR_s00021p00185480 I 0.000
AMTR_s00049p00214620 Amborella trichopoda AMTR_s00049p00214620 I 0.000
AMTR_s00057p00191330 Amborella trichopoda AMTR_s00057p00191330 I 0.000
AMTR_s00111p00113030 Amborella trichopoda AMTR_s00111p00113030 I 0.000
AMTR_s00115p00032780 Amborella trichopoda AMTR_s00115p00032780 I 0.000
AMTR_s00129p00112550 Amborella trichopoda AMTR_s00129p00112550 I 0.000
AMTR_s00148p00084540 Amborella trichopoda AMTR_s00148p00084540 I 0.000
Aquca_005_00139 Aquilegia coerulea Aquca_005_00139 I 0.000
Aquca_005_00143 Aquilegia coerulea Aquca_005_00143 I 0.000
Aquca_011_00500 Aquilegia coerulea Aquca_011_00500 I 0.000
Aquca_013_00162 Aquilegia coerulea Aquca_013_00162 I 0.000
Aquca_015_00126 Aquilegia coerulea Aquca_015_00126 I 0.000
Aquca_017_00248 Aquilegia coerulea Aquca_017_00248 I 0.000
Aquca_017_00710 Aquilegia coerulea Aquca_017_00710 I 0.000
Aquca_017_00711 Aquilegia coerulea Aquca_017_00711 I 0.000
Aquca_020_00575 Aquilegia coerulea Aquca_020_00575 I 0.000
Aquca_034_00376 Aquilegia coerulea Aquca_034_00376 I 0.000
Aquca_036_00070 Aquilegia coerulea Aquca_036_00070 I 0.000
Aquca_067_00004 Aquilegia coerulea Aquca_067_00004 I 0.000
Aquca_067_00006 Aquilegia coerulea Aquca_067_00006 I 0.000
Aquca_067_00007 Aquilegia coerulea Aquca_067_00007 I 0.000
Aquca_076_00008 Aquilegia coerulea Aquca_076_00008 I 0.000
ERF14 Arabidopsis thaliana AT1G04370 D 0.000
ESR2 Arabidopsis thaliana AT1G24590 I 0.000
AT2G33710 Arabidopsis thaliana AT2G33710 D 0.000
RAP2-2 Arabidopsis thaliana AT3G14230 D 0.000
ERF095 Arabidopsis thaliana AT3G23220 D 0.000
ERF098 Arabidopsis thaliana AT3G23230 D 0.000
ERF1B Arabidopsis thaliana AT3G23240 D 0.000
ERF6 Arabidopsis thaliana AT4G17490 D 0.000
ERF1A Arabidopsis thaliana AT4G17500 D 0.000
ERF106 Arabidopsis thaliana AT5G07580 D 0.000
ERF113 Arabidopsis thaliana AT5G13330 D 0.000
LEP Arabidopsis thaliana AT5G13910 D 0.000
ERF086 Arabidopsis thaliana AT5G18560 D 0.000
ERF096 Arabidopsis thaliana AT5G43410 D 0.000
ERF9 Arabidopsis thaliana AT5G44210 D 0.000
ERF2 Arabidopsis thaliana AT5G47220 D 0.000
ERF5 Arabidopsis thaliana AT5G47230 D 0.000
ERF105 Arabidopsis thaliana AT5G51190 D 0.000
ERF107 Arabidopsis thaliana AT5G61590 I 0.000
ERF104 Arabidopsis thaliana AT5G61600 D 0.000
BGIOSGA001090 Oryza indica BGIOSGA001090 I 0.000
BGIOSGA004470 Oryza indica BGIOSGA004470 I 0.000
BGIOSGA004611 Oryza indica BGIOSGA004611 I 0.000
BGIOSGA005915 Oryza indica BGIOSGA005915 I 0.000
BGIOSGA008740 Oryza indica BGIOSGA008740 I 0.000
BGIOSGA009392 Oryza indica BGIOSGA009392 I 0.000
BGIOSGA011328 Oryza indica BGIOSGA011328 I 0.000
BGIOSGA011868 Oryza indica BGIOSGA011868 I 0.000
BGIOSGA014605 Oryza indica BGIOSGA014605 I 0.000
BGIOSGA015474 Oryza indica BGIOSGA015474 I 0.000
BGIOSGA016873 Oryza indica BGIOSGA016873 I 0.000
BGIOSGA016874 Oryza indica BGIOSGA016874 I 0.000
BGIOSGA017558 Oryza indica BGIOSGA017558 I 0.000
BGIOSGA017796 Oryza indica BGIOSGA017796 I 0.000
BGIOSGA019701 Oryza indica BGIOSGA019701 I 0.000
BGIOSGA023741 Oryza indica BGIOSGA023741 I 0.000
BGIOSGA029230 Oryza indica BGIOSGA029230 I 0.000
BGIOSGA030907 Oryza indica BGIOSGA030907 I 0.000
BGIOSGA031822 Oryza indica BGIOSGA031822 I 0.000
BGIOSGA033447 Oryza indica BGIOSGA033447 I 0.000
Bo14558s010 Brassica oleracea Bo14558s010 I 0.000
Bo1g017580 Brassica oleracea Bo1g017580 I 0.000
Bo1g017590 Brassica oleracea Bo1g017590 I 0.000
Bo1g019590 Brassica oleracea Bo1g019590 I 0.000
Bo1g019600 Brassica oleracea Bo1g019600 I 0.000
Bo1g102210 Brassica oleracea Bo1g102210 I 0.000
Bo2g008700 Brassica oleracea Bo2g008700 I 0.000
Bo2g011200 Brassica oleracea Bo2g011200 I 0.000
Bo2g011600 Brassica oleracea Bo2g011600 I 0.000
Bo2g016580 Brassica oleracea Bo2g016580 I 0.000
Bo2g132270 Brassica oleracea Bo2g132270 I 0.000
Bo2g161480 Brassica oleracea Bo2g161480 I 0.000
Bo3g009120 Brassica oleracea Bo3g009120 I 0.000
Bo3g009410 Brassica oleracea Bo3g009410 I 0.000
Bo3g013220 Brassica oleracea Bo3g013220 I 0.000
Bo3g140080 Brassica oleracea Bo3g140080 I 0.000
Bo4g009400 Brassica oleracea Bo4g009400 I 0.000
Bo4g043530 Brassica oleracea Bo4g043530 I 0.000
Bo4g182140 Brassica oleracea Bo4g182140 I 0.000
Bo4g198690 Brassica oleracea Bo4g198690 I 0.000
Bo5g004520 Brassica oleracea Bo5g004520 I 0.000
Bo5g007280 Brassica oleracea Bo5g007280 I 0.000
Bo5g055860 Brassica oleracea Bo5g055860 I 0.000
Bo5g130490 Brassica oleracea Bo5g130490 I 0.000
Bo7g040820 Brassica oleracea Bo7g040820 I 0.000
Bo7g050300 Brassica oleracea Bo7g050300 I 0.000
Bo7g077390 Brassica oleracea Bo7g077390 I 0.000
Bo7g077410 Brassica oleracea Bo7g077410 I 0.000
Bo7g098850 Brassica oleracea Bo7g098850 I 0.000
Bo7g098860 Brassica oleracea Bo7g098860 I 0.000
Bo7g111760 Brassica oleracea Bo7g111760 I 0.000
Bo8g049450 Brassica oleracea Bo8g049450 I 0.000
Bo8g049470 Brassica oleracea Bo8g049470 I 0.000
Bo8g096140 Brassica oleracea Bo8g096140 I 0.000
Bo8g114710 Brassica oleracea Bo8g114710 I 0.000
Bo8g115580 Brassica oleracea Bo8g115580 I 0.000
Bo8g118250 Brassica oleracea Bo8g118250 I 0.000
Bo9g001020 Brassica oleracea Bo9g001020 I 0.000
Bo9g014660 Brassica oleracea Bo9g014660 I 0.000
Bo9g059180 Brassica oleracea Bo9g059180 I 0.000
Bo9g069400 Brassica oleracea Bo9g069400 I 0.000
Bo9g069410 Brassica oleracea Bo9g069410 I 0.000
Bo9g100030 Brassica oleracea Bo9g100030 I 0.000
Bo9g154770 Brassica oleracea Bo9g154770 I 0.000
Bo9g166320 Brassica oleracea Bo9g166320 I 0.000
Bo9g167820 Brassica oleracea Bo9g167820 I 0.000
Bo9g175610 Brassica oleracea Bo9g175610 I 0.000
Bostr.10273s0115 Boechera stricta Bostr.10273s0115 I 0.000
Bostr.13129s0205 Boechera stricta Bostr.13129s0205 I 0.000
Bostr.14419s0016 Boechera stricta Bostr.14419s0016 I 0.000
Bostr.14419s0017 Boechera stricta Bostr.14419s0017 I 0.000
Bostr.14547s0008 Boechera stricta Bostr.14547s0008 I 0.000
Bostr.15697s0023 Boechera stricta Bostr.15697s0023 I 0.000
Bostr.15774s0261 Boechera stricta Bostr.15774s0261 I 0.000
Bostr.15774s0262 Boechera stricta Bostr.15774s0262 I 0.000
Bostr.19424s0319 Boechera stricta Bostr.19424s0319 I 0.000
Bostr.19424s0320 Boechera stricta Bostr.19424s0320 I 0.000
Bostr.19424s0321 Boechera stricta Bostr.19424s0321 I 0.000
Bostr.23794s0729 Boechera stricta Bostr.23794s0729 I 0.000
Bostr.25219s0341 Boechera stricta Bostr.25219s0341 I 0.000
Bostr.25993s0004 Boechera stricta Bostr.25993s0004 I 0.000
Bostr.25993s0288 Boechera stricta Bostr.25993s0288 I 0.000
Bostr.26527s0355 Boechera stricta Bostr.26527s0355 I 0.000
Bostr.26675s0318 Boechera stricta Bostr.26675s0318 I 0.000
Bostr.26833s0076 Boechera stricta Bostr.26833s0076 I 0.000
Bostr.26833s0077 Boechera stricta Bostr.26833s0077 I 0.000
Bostr.28625s0277 Boechera stricta Bostr.28625s0277 I 0.000
Bostr.2902s0068 Boechera stricta Bostr.2902s0068 I 0.000
Bostr.2902s0126 Boechera stricta Bostr.2902s0126 I 0.000
Bostr.30275s0206 Boechera stricta Bostr.30275s0206 I 0.000
Bostr.30275s0207 Boechera stricta Bostr.30275s0207 I 0.000
Bostr.30275s0319 Boechera stricta Bostr.30275s0319 I 0.000
Bostr.3148s0037 Boechera stricta Bostr.3148s0037 I 0.000
Bostr.3148s0125 Boechera stricta Bostr.3148s0125 I 0.000
Bra001541 Brassica rapa Bra001541 I 0.000
Bra002168 Brassica rapa Bra002168 I 0.000
Bra004548 Brassica rapa Bra004548 I 0.000
Bra005480 Brassica rapa Bra005480 I 0.000
Bra006195 Brassica rapa Bra006195 I 0.000
Bra006466 Brassica rapa Bra006466 I 0.000
Bra008793 Brassica rapa Bra008793 I 0.000
Bra008835 Brassica rapa Bra008835 I 0.000
Bra009250 Brassica rapa Bra009250 I 0.000
Bra010972 Brassica rapa Bra010972 I 0.000
Bra012499 Brassica rapa Bra012499 I 0.000
Bra012938 Brassica rapa Bra012938 I 0.000
Bra012939 Brassica rapa Bra012939 I 0.000
Bra013310 Brassica rapa Bra013310 I 0.000
Bra014924 Brassica rapa Bra014924 I 0.000
Bra015266 Brassica rapa Bra015266 I 0.000
Bra015310 Brassica rapa Bra015310 I 0.000
Bra015478 Brassica rapa Bra015478 I 0.000
Bra017493 Brassica rapa Bra017493 I 0.000
Bra017495 Brassica rapa Bra017495 I 0.000
Bra017612 Brassica rapa Bra017612 I 0.000
Bra021047 Brassica rapa Bra021047 I 0.000
Bra021048 Brassica rapa Bra021048 I 0.000
Bra021049 Brassica rapa Bra021049 I 0.000
Bra021401 Brassica rapa Bra021401 I 0.000
Bra021543 Brassica rapa Bra021543 I 0.000
Bra021871 Brassica rapa Bra021871 I 0.000
Bra022115 Brassica rapa Bra022115 I 0.000
Bra023404 Brassica rapa Bra023404 I 0.000
Bra023440 Brassica rapa Bra023440 I 0.000
Bra023684 Brassica rapa Bra023684 I 0.000
Bra023745 Brassica rapa Bra023745 I 0.000
Bra023746 Brassica rapa Bra023746 I 0.000
Bra024953 Brassica rapa Bra024953 I 0.000
Bra024954 Brassica rapa Bra024954 I 0.000
Bra027355 Brassica rapa Bra027355 I 0.000
Bra027447 Brassica rapa Bra027447 I 0.000
Bra027493 Brassica rapa Bra027493 I 0.000
Bra028690 Brassica rapa Bra028690 I 0.000
Bra029319 Brassica rapa Bra029319 I 0.000
Bra032433 Brassica rapa Bra032433 I 0.000
Bra032512 Brassica rapa Bra032512 I 0.000
Bra032665 Brassica rapa Bra032665 I 0.000
Bra035732 Brassica rapa Bra035732 I 0.000
Bra035919 Brassica rapa Bra035919 I 0.000
Bra040158 Brassica rapa Bra040158 I 0.000
Bra040159 Brassica rapa Bra040159 I 0.000
Bra040839 Brassica rapa Bra040839 I 0.000
BRADI1G18580 Brachypodium distachyon BRADI1G18580 I 0.000
BRADI1G46690 Brachypodium distachyon BRADI1G46690 I 0.000
BRADI1G75040 Brachypodium distachyon BRADI1G75040 I 0.000
BRADI2G21060 Brachypodium distachyon BRADI2G21060 I 0.000
BRADI2G27920 Brachypodium distachyon BRADI2G27920 I 0.000
BRADI2G31480 Brachypodium distachyon BRADI2G31480 I 0.000
BRADI2G45530 Brachypodium distachyon BRADI2G45530 I 0.000
BRADI2G52370 Brachypodium distachyon BRADI2G52370 I 0.000
BRADI3G27690 Brachypodium distachyon BRADI3G27690 I 0.000
BRADI3G38140 Brachypodium distachyon BRADI3G38140 I 0.000
BRADI3G50490 Brachypodium distachyon BRADI3G50490 I 0.000
BRADI5G17490 Brachypodium distachyon BRADI5G17490 I 0.000
Cagra.0244s0009 Capsella grandiflora Cagra.0244s0009 I 0.000
Cagra.0301s0013 Capsella grandiflora Cagra.0301s0013 I 0.000
Cagra.0381s0006 Capsella grandiflora Cagra.0381s0006 I 0.000
Cagra.0542s0054 Capsella grandiflora Cagra.0542s0054 I 0.000
Cagra.0542s0055 Capsella grandiflora Cagra.0542s0055 I 0.000
Cagra.0551s0010 Capsella grandiflora Cagra.0551s0010 I 0.000
Cagra.0712s0022 Capsella grandiflora Cagra.0712s0022 I 0.000
Cagra.1582s0005 Capsella grandiflora Cagra.1582s0005 I 0.000
Cagra.1671s0052 Capsella grandiflora Cagra.1671s0052 I 0.000
Cagra.1671s0247 Capsella grandiflora Cagra.1671s0247 I 0.000
Cagra.2231s0001 Capsella grandiflora Cagra.2231s0001 I 0.000
Cagra.2925s0026 Capsella grandiflora Cagra.2925s0026 I 0.000
Cagra.2935s0012 Capsella grandiflora Cagra.2935s0012 I 0.000
Cagra.3356s0040 Capsella grandiflora Cagra.3356s0040 I 0.000
Cagra.3356s0041 Capsella grandiflora Cagra.3356s0041 I 0.000
Cagra.3675s0006 Capsella grandiflora Cagra.3675s0006 I 0.000
Cagra.3675s0007 Capsella grandiflora Cagra.3675s0007 I 0.000
Cagra.3782s0035 Capsella grandiflora Cagra.3782s0035 I 0.000
Cagra.3782s0036 Capsella grandiflora Cagra.3782s0036 I 0.000
Cagra.4714s0001 Capsella grandiflora Cagra.4714s0001 I 0.000
Cagra.5588s0020 Capsella grandiflora Cagra.5588s0020 I 0.000
Cagra.8559s0001 Capsella grandiflora Cagra.8559s0001 I 0.000
Cagra.8559s0002 Capsella grandiflora Cagra.8559s0002 I 0.000
Carubv10001831m.g Capsella rubella Carubv10001831m.g I 0.000
Carubv10001989m.g Capsella rubella Carubv10001989m.g I 0.000
Carubv10002480m.g Capsella rubella Carubv10002480m.g I 0.000
Carubv10002663m.g Capsella rubella Carubv10002663m.g I 0.000
Carubv10005314m.g Capsella rubella Carubv10005314m.g I 0.000
Carubv10005497m.g Capsella rubella Carubv10005497m.g I 0.000
Carubv10005868m.g Capsella rubella Carubv10005868m.g I 0.000
Carubv10006457m.g Capsella rubella Carubv10006457m.g I 0.000
Carubv10010105m.g Capsella rubella Carubv10010105m.g I 0.000
Carubv10011057m.g Capsella rubella Carubv10011057m.g I 0.000
Carubv10012164m.g Capsella rubella Carubv10012164m.g I 0.000
Carubv10013925m.g Capsella rubella Carubv10013925m.g I 0.000
Carubv10014553m.g Capsella rubella Carubv10014553m.g I 0.000
Carubv10014873m.g Capsella rubella Carubv10014873m.g I 0.000
Carubv10015406m.g Capsella rubella Carubv10015406m.g I 0.000
Carubv10025511m.g Capsella rubella Carubv10025511m.g I 0.000
Carubv10025530m.g Capsella rubella Carubv10025530m.g I 0.000
Carubv10027063m.g Capsella rubella Carubv10027063m.g I 0.000
Carubv10027108m.g Capsella rubella Carubv10027108m.g I 0.000
Carubv10027246m.g Capsella rubella Carubv10027246m.g I 0.000
Carubv10027677m.g Capsella rubella Carubv10027677m.g I 0.000
Carubv10027835m.g Capsella rubella Carubv10027835m.g I 0.000
Carubv10028209m.g Capsella rubella Carubv10028209m.g I 0.000
Carubv10028227m.g Capsella rubella Carubv10028227m.g I 0.000
Carubv10028472m.g Capsella rubella Carubv10028472m.g I 0.000
cassava11359.m1 Manihot esculenta cassava11359.m1 I 0.000
cassava11599.m1 Manihot esculenta cassava11599.m1 I 0.000
cassava1589.valid.m1 Manihot esculenta cassava1589.valid.m1 I 0.000
cassava1608.valid.m1 Manihot esculenta cassava1608.valid.m1 I 0.000
cassava18871.valid.m1 Manihot esculenta cassava18871.valid.m1 I 0.000
cassava18872.valid.m1 Manihot esculenta cassava18872.valid.m1 I 0.000
cassava19171.valid.m1 Manihot esculenta cassava19171.valid.m1 I 0.000
cassava20937.m1 Manihot esculenta cassava20937.m1 I 0.000
cassava21353.m1 Manihot esculenta cassava21353.m1 I 0.000
cassava21524.m1 Manihot esculenta cassava21524.m1 I 0.000
cassava21525.m1 Manihot esculenta cassava21525.m1 I 0.000
cassava21600.m1 Manihot esculenta cassava21600.m1 I 0.000
cassava24734.valid.m1 Manihot esculenta cassava24734.valid.m1 I 0.000
cassava3045.m1 Manihot esculenta cassava3045.m1 I 0.000
cassava31609.valid.m1 Manihot esculenta cassava31609.valid.m1 I 0.000
cassava31610.valid.m1 Manihot esculenta cassava31610.valid.m1 I 0.000
cassava32131.m1 Manihot esculenta cassava32131.m1 I 0.000
cassava32306.m1 Manihot esculenta cassava32306.m1 I 0.000
cassava3323.m1 Manihot esculenta cassava3323.m1 I 0.000
cassava33325.m1 Manihot esculenta cassava33325.m1 I 0.000
cassava38228.valid.m1 Manihot esculenta cassava38228.valid.m1 I 0.000
cassava38508.m1 Manihot esculenta cassava38508.m1 I 0.000
cassava38509.m1 Manihot esculenta cassava38509.m1 I 0.000
cassava38545.m1 Manihot esculenta cassava38545.m1 I 0.000
cassava41615.m1 Manihot esculenta cassava41615.m1 I 0.000
cassava41639.m1 Manihot esculenta cassava41639.m1 I 0.000
cassava44000.valid.m1 Manihot esculenta cassava44000.valid.m1 I 0.000
cassava4507.m1 Manihot esculenta cassava4507.m1 I 0.000
cassava46560.m1 Manihot esculenta cassava46560.m1 I 0.000
cassava46974.m1 Manihot esculenta cassava46974.m1 I 0.000
cassava47034.m1 Manihot esculenta cassava47034.m1 I 0.000
cassava4871.m1 Manihot esculenta cassava4871.m1 I 0.000
cassava4887.m1 Manihot esculenta cassava4887.m1 I 0.000
cassava4888.m1 Manihot esculenta cassava4888.m1 I 0.000
cassava631.valid.m1 Manihot esculenta cassava631.valid.m1 I 0.000
cassava632.valid.m1 Manihot esculenta cassava632.valid.m1 I 0.000
Ca_00327 Cicer arietinum Ca_00327 I 0.000
Ca_00359 Cicer arietinum Ca_00359 I 0.000
Ca_00360 Cicer arietinum Ca_00360 I 0.000
Ca_00514 Cicer arietinum Ca_00514 I 0.000
Ca_02325 Cicer arietinum Ca_02325 I 0.000
Ca_03481 Cicer arietinum Ca_03481 I 0.000
Ca_03482 Cicer arietinum Ca_03482 I 0.000
Ca_06034 Cicer arietinum Ca_06034 I 0.000
Ca_06835 Cicer arietinum Ca_06835 I 0.000
Ca_07755 Cicer arietinum Ca_07755 I 0.000
Ca_08291 Cicer arietinum Ca_08291 I 0.000
Ca_11261 Cicer arietinum Ca_11261 I 0.000
Ca_12079 Cicer arietinum Ca_12079 I 0.000
Ca_12218 Cicer arietinum Ca_12218 I 0.000
Ca_12220 Cicer arietinum Ca_12220 I 0.000
Ca_12221 Cicer arietinum Ca_12221 I 0.000
Ca_12774 Cicer arietinum Ca_12774 I 0.000
Ca_12775 Cicer arietinum Ca_12775 I 0.000
Ca_15022 Cicer arietinum Ca_15022 I 0.000
Ca_16180 Cicer arietinum Ca_16180 I 0.000
Ca_17212 Cicer arietinum Ca_17212 I 0.000
Ca_18127 Cicer arietinum Ca_18127 I 0.000
Ca_20349 Cicer arietinum Ca_20349 I 0.000
Ca_22534 Cicer arietinum Ca_22534 I 0.000
Ca_23170 Cicer arietinum Ca_23170 I 0.000
Ca_23626 Cicer arietinum Ca_23626 I 0.000
CHLREDRAFT_190235 Chlamydomonas reinhardtii CHLREDRAFT_190235 I 0.000
chr1.CM0222.280.nd Lotus japonicus chr1.CM0222.280.nd I 0.000
chr1.CM0295.140.nd Lotus japonicus chr1.CM0295.140.nd I 0.000
chr3.CM0080.200.nd Lotus japonicus chr3.CM0080.200.nd I 0.000
chr5.CM0909.360.nc Lotus japonicus chr5.CM0909.360.nc I 0.000
chr6.CM0114.120.nc Lotus japonicus chr6.CM0114.120.nc I 0.000
chr6.CM1613.110.nc Lotus japonicus chr6.CM1613.110.nc I 0.000
Ciclev10002183m.g Citrus clementina Ciclev10002183m.g I 0.000
Ciclev10005570m.g Citrus clementina Ciclev10005570m.g I 0.000
Ciclev10005750m.g Citrus clementina Ciclev10005750m.g I 0.000
Ciclev10005787m.g Citrus clementina Ciclev10005787m.g I 0.000
Ciclev10005820m.g Citrus clementina Ciclev10005820m.g I 0.000
Ciclev10005863m.g Citrus clementina Ciclev10005863m.g I 0.000
Ciclev10005891m.g Citrus clementina Ciclev10005891m.g I 0.000
Ciclev10006784m.g Citrus clementina Ciclev10006784m.g I 0.000
Ciclev10006861m.g Citrus clementina Ciclev10006861m.g I 0.000
Ciclev10007133m.g Citrus clementina Ciclev10007133m.g I 0.000
Ciclev10016276m.g Citrus clementina Ciclev10016276m.g I 0.000
Ciclev10016463m.g Citrus clementina Ciclev10016463m.g I 0.000
Ciclev10016995m.g Citrus clementina Ciclev10016995m.g I 0.000
Ciclev10017494m.g Citrus clementina Ciclev10017494m.g I 0.000
Ciclev10018130m.g Citrus clementina Ciclev10018130m.g I 0.000
Ciclev10021059m.g Citrus clementina Ciclev10021059m.g I 0.000
Ciclev10021285m.g Citrus clementina Ciclev10021285m.g I 0.000
Ciclev10021652m.g Citrus clementina Ciclev10021652m.g I 0.000
Ciclev10023286m.g Citrus clementina Ciclev10023286m.g I 0.000
Ciclev10023352m.g Citrus clementina Ciclev10023352m.g I 0.000
Ciclev10023393m.g Citrus clementina Ciclev10023393m.g I 0.000
Ciclev10023546m.g Citrus clementina Ciclev10023546m.g I 0.000
Ciclev10023656m.g Citrus clementina Ciclev10023656m.g I 0.000
Ciclev10023730m.g Citrus clementina Ciclev10023730m.g I 0.000
Ciclev10024451m.g Citrus clementina Ciclev10024451m.g I 0.000
Ciclev10028930m.g Citrus clementina Ciclev10028930m.g I 0.000
Ciclev10031612m.g Citrus clementina Ciclev10031612m.g I 0.000
Cla002268 Citrullus lanatus Cla002268 I 0.000
Cla003677 Citrullus lanatus Cla003677 I 0.000
Cla003678 Citrullus lanatus Cla003678 I 0.000
Cla003706 Citrullus lanatus Cla003706 I 0.000
Cla004992 Citrullus lanatus Cla004992 I 0.000
Cla005705 Citrullus lanatus Cla005705 I 0.000
Cla005706 Citrullus lanatus Cla005706 I 0.000
Cla006080 Citrullus lanatus Cla006080 I 0.000
Cla007696 Citrullus lanatus Cla007696 I 0.000
Cla007697 Citrullus lanatus Cla007697 I 0.000
Cla009438 Citrullus lanatus Cla009438 I 0.000
Cla009795 Citrullus lanatus Cla009795 I 0.000
Cla009821 Citrullus lanatus Cla009821 I 0.000
Cla009822 Citrullus lanatus Cla009822 I 0.000
Cla010206 Citrullus lanatus Cla010206 I 0.000
Cla010886 Citrullus lanatus Cla010886 I 0.000
Cla010887 Citrullus lanatus Cla010887 I 0.000
Cla012751 Citrullus lanatus Cla012751 I 0.000
Cla013632 Citrullus lanatus Cla013632 I 0.000
Cla015064 Citrullus lanatus Cla015064 I 0.000
Cla015763 Citrullus lanatus Cla015763 I 0.000
Cla017662 Citrullus lanatus Cla017662 I 0.000
Cla020000 Citrullus lanatus Cla020000 I 0.000
Cla021384 Citrullus lanatus Cla021384 I 0.000
Cla021505 Citrullus lanatus Cla021505 I 0.000
Cla021850 Citrullus lanatus Cla021850 I 0.000
Cla021851 Citrullus lanatus Cla021851 I 0.000
Cla021852 Citrullus lanatus Cla021852 I 0.000
Cla023087 Citrullus lanatus Cla023087 I 0.000
CM0905.90.nd Lotus japonicus CM0905.90.nd I 0.000
CM1489.100.nc Lotus japonicus CM1489.100.nc I 0.000
CM1489.90.nc Lotus japonicus CM1489.90.nc I 0.000
Cucsa.046390 Cucumis sativus Cucsa.046390 I 0.000
Cucsa.046660 Cucumis sativus Cucsa.046660 I 0.000
Cucsa.053560 Cucumis sativus Cucsa.053560 I 0.000
Cucsa.069280 Cucumis sativus Cucsa.069280 I 0.000
Cucsa.094100 Cucumis sativus Cucsa.094100 I 0.000
Cucsa.096930 Cucumis sativus Cucsa.096930 I 0.000
Cucsa.126880 Cucumis sativus Cucsa.126880 I 0.000
Cucsa.129320 Cucumis sativus Cucsa.129320 I 0.000
Cucsa.129330 Cucumis sativus Cucsa.129330 I 0.000
Cucsa.129630 Cucumis sativus Cucsa.129630 I 0.000
Cucsa.149280 Cucumis sativus Cucsa.149280 I 0.000
Cucsa.195660 Cucumis sativus Cucsa.195660 I 0.000
Cucsa.252810 Cucumis sativus Cucsa.252810 I 0.000
Cucsa.253400 Cucumis sativus Cucsa.253400 I 0.000
Cucsa.255320 Cucumis sativus Cucsa.255320 I 0.000
Cucsa.255340 Cucumis sativus Cucsa.255340 I 0.000
Cucsa.258900 Cucumis sativus Cucsa.258900 I 0.000
Cucsa.260040 Cucumis sativus Cucsa.260040 I 0.000
Cucsa.286530 Cucumis sativus Cucsa.286530 I 0.000
Cucsa.321150 Cucumis sativus Cucsa.321150 I 0.000
Cucsa.321160 Cucumis sativus Cucsa.321160 I 0.000
Cucsa.359880 Cucumis sativus Cucsa.359880 I 0.000
Cucsa.383680 Cucumis sativus Cucsa.383680 I 0.000
Cucsa.394520 Cucumis sativus Cucsa.394520 I 0.000
ERF2_TOBAC Nicotiana tabacum ERF2_TOBAC D 0.000
ERF4_TOBAC Nicotiana tabacum ERF4_TOBAC D 0.000
ERF5_TOBAC Nicotiana tabacum ERF5_TOBAC D 0.000
Eucgr.A02924 Eucalyptus grandis Eucgr.A02924 I 0.000
Eucgr.B00720 Eucalyptus grandis Eucgr.B00720 I 0.000
Eucgr.B01537 Eucalyptus grandis Eucgr.B01537 I 0.000
Eucgr.B03559 Eucalyptus grandis Eucgr.B03559 I 0.000
Eucgr.B03565 Eucalyptus grandis Eucgr.B03565 I 0.000
Eucgr.D01775 Eucalyptus grandis Eucgr.D01775 I 0.000
Eucgr.D02111 Eucalyptus grandis Eucgr.D02111 I 0.000
Eucgr.E00377 Eucalyptus grandis Eucgr.E00377 I 0.000
Eucgr.E00378 Eucalyptus grandis Eucgr.E00378 I 0.000
Eucgr.E01561 Eucalyptus grandis Eucgr.E01561 I 0.000
Eucgr.E02651 Eucalyptus grandis Eucgr.E02651 I 0.000
Eucgr.E02652 Eucalyptus grandis Eucgr.E02652 I 0.000
Eucgr.E03167 Eucalyptus grandis Eucgr.E03167 I 0.000
Eucgr.E03168 Eucalyptus grandis Eucgr.E03168 I 0.000
Eucgr.G00390 Eucalyptus grandis Eucgr.G00390 I 0.000
Eucgr.G00391 Eucalyptus grandis Eucgr.G00391 I 0.000
Eucgr.G00393 Eucalyptus grandis Eucgr.G00393 I 0.000
Eucgr.G00394 Eucalyptus grandis Eucgr.G00394 I 0.000
Eucgr.G00396 Eucalyptus grandis Eucgr.G00396 I 0.000
Eucgr.G00397 Eucalyptus grandis Eucgr.G00397 I 0.000
Eucgr.H00170 Eucalyptus grandis Eucgr.H00170 I 0.000
Eucgr.H00172 Eucalyptus grandis Eucgr.H00172 I 0.000
Eucgr.H00177 Eucalyptus grandis Eucgr.H00177 I 0.000
Eucgr.H01085 Eucalyptus grandis Eucgr.H01085 I 0.000
Eucgr.H02495 Eucalyptus grandis Eucgr.H02495 I 0.000
Eucgr.H03090 Eucalyptus grandis Eucgr.H03090 I 0.000
Eucgr.H03091 Eucalyptus grandis Eucgr.H03091 I 0.000
Eucgr.H03870 Eucalyptus grandis Eucgr.H03870 I 0.000
Eucgr.H04254 Eucalyptus grandis Eucgr.H04254 I 0.000
Eucgr.I01576 Eucalyptus grandis Eucgr.I01576 I 0.000
Eucgr.I02155 Eucalyptus grandis Eucgr.I02155 I 0.000
Eucgr.K00126 Eucalyptus grandis Eucgr.K00126 I 0.000
Eucgr.K00128 Eucalyptus grandis Eucgr.K00128 I 0.000
evm.TU.supercontig_101.16 Carica papaya evm.TU.supercontig_101.16 I 0.000
evm.TU.supercontig_13.250 Carica papaya evm.TU.supercontig_13.250 I 0.000
evm.TU.supercontig_13.253 Carica papaya evm.TU.supercontig_13.253 I 0.000
evm.TU.supercontig_151.30 Carica papaya evm.TU.supercontig_151.30 I 0.000
evm.TU.supercontig_16.148 Carica papaya evm.TU.supercontig_16.148 I 0.000
evm.TU.supercontig_194.13 Carica papaya evm.TU.supercontig_194.13 I 0.000
evm.TU.supercontig_27.16 Carica papaya evm.TU.supercontig_27.16 I 0.000
evm.TU.supercontig_33.29 Carica papaya evm.TU.supercontig_33.29 I 0.000
evm.TU.supercontig_38.79 Carica papaya evm.TU.supercontig_38.79 I 0.000
evm.TU.supercontig_44.71 Carica papaya evm.TU.supercontig_44.71 I 0.000
evm.TU.supercontig_44.74 Carica papaya evm.TU.supercontig_44.74 I 0.000
evm.TU.supercontig_481.1 Carica papaya evm.TU.supercontig_481.1 I 0.000
evm.TU.supercontig_50.28 Carica papaya evm.TU.supercontig_50.28 I 0.000
evm.TU.supercontig_50.29 Carica papaya evm.TU.supercontig_50.29 I 0.000
evm.TU.supercontig_55.155 Carica papaya evm.TU.supercontig_55.155 I 0.000
evm.TU.supercontig_62.11 Carica papaya evm.TU.supercontig_62.11 I 0.000
evm.TU.supercontig_7.36 Carica papaya evm.TU.supercontig_7.36 I 0.000
evm.TU.supercontig_70.47 Carica papaya evm.TU.supercontig_70.47 I 0.000
evm.TU.supercontig_83.80 Carica papaya evm.TU.supercontig_83.80 I 0.000
evm.TU.supercontig_89.42 Carica papaya evm.TU.supercontig_89.42 I 0.000
e_gw1.265.11.1 Physcomitrella patens e_gw1.265.11.1 I 0.000
e_gw1.357.22.1 Physcomitrella patens e_gw1.357.22.1 I 0.000
e_gw1.487.2.1 Physcomitrella patens e_gw1.487.2.1 I 0.000
e_gw1.53.114.1 Physcomitrella patens e_gw1.53.114.1 I 0.000
e_gw1.60.113.1 Physcomitrella patens e_gw1.60.113.1 I 0.000
e_gw1.72.116.1 Physcomitrella patens e_gw1.72.116.1 I 0.000
F775_01857 Aegilops tauschii F775_01857 I 0.000
F775_03520 Aegilops tauschii F775_03520 I 0.000
F775_13439 Aegilops tauschii F775_13439 I 0.000
F775_21583 Aegilops tauschii F775_21583 I 0.000
F775_22380 Aegilops tauschii F775_22380 I 0.000
F775_23071 Aegilops tauschii F775_23071 I 0.000
F775_27248 Aegilops tauschii F775_27248 I 0.000
ORA59 Arabidopsis lyrata fgenesh2_kg.1__587__AT1G06160.1 I 0.000
fgenesh2_kg.3__2537__AT3G23220.1 Arabidopsis lyrata fgenesh2_kg.3__2537__AT3G23220.1 I 0.000
fgenesh2_kg.3__2538__AT3G23230.1 Arabidopsis lyrata fgenesh2_kg.3__2538__AT3G23230.1 I 0.000
fgenesh2_kg.471__1__AT3G23230.1 Arabidopsis lyrata fgenesh2_kg.471__1__AT3G23230.1 I 0.000
fgenesh2_kg.4__1380__AT2G33710.1 Arabidopsis lyrata fgenesh2_kg.4__1380__AT2G33710.1 I 0.000
HRE2 Arabidopsis lyrata fgenesh2_kg.4__2993__AT2G47520.1 I 0.000
Rap2.6L Arabidopsis lyrata fgenesh2_kg.6__1285__AT5G13330.1 I 0.000
PUCHI Arabidopsis lyrata fgenesh2_kg.6__1873__AT5G18560.1 I 0.000
ATERF-1 Arabidopsis lyrata fgenesh2_kg.7__2559__AT4G17500.1 I 0.000
ATERF6 Arabidopsis lyrata fgenesh2_kg.7__2560__AT4G17490.1 I 0.000
fgenesh2_kg.8__1005__AT5G51190.1 Arabidopsis lyrata fgenesh2_kg.8__1005__AT5G51190.1 I 0.000
fgenesh2_kg.8__2142__AT5G61590.1 Arabidopsis lyrata fgenesh2_kg.8__2142__AT5G61590.1 I 0.000
ERF104 Arabidopsis lyrata fgenesh2_kg.8__2143__AT5G61600.1 I 0.000
ERF9 Arabidopsis lyrata fgenesh2_kg.8__388__AT5G44210.1 I 0.000
ERF5 Arabidopsis lyrata fgenesh2_kg.8__69__AT5G47230.1 I 0.000
ATERF2 Arabidopsis lyrata fgenesh2_kg.8__70__AT5G47220.1 I 0.000
fgenesh4_pg.C_scaffold_15000094 Volvox carteri fgenesh4_pg.C_scaffold_15000094 I 0.000
gene04913-v1.0-hybrid Fragaria vesca gene04913-v1.0-hybrid I 0.000
gene04916-v1.0-hybrid Fragaria vesca gene04916-v1.0-hybrid I 0.000
gene04917-v1.0-hybrid Fragaria vesca gene04917-v1.0-hybrid I 0.000
gene05448-v1.0-hybrid Fragaria vesca gene05448-v1.0-hybrid I 0.000
gene06790-v1.0-hybrid Fragaria vesca gene06790-v1.0-hybrid I 0.000
gene08071-v1.0-hybrid Fragaria vesca gene08071-v1.0-hybrid I 0.000
gene08072-v1.0-hybrid Fragaria vesca gene08072-v1.0-hybrid I 0.000
gene08073-v1.0-hybrid Fragaria vesca gene08073-v1.0-hybrid I 0.000
gene08074-v1.0-hybrid Fragaria vesca gene08074-v1.0-hybrid I 0.000
gene10841-v1.0-hybrid Fragaria vesca gene10841-v1.0-hybrid I 0.000
gene10845-v1.0-hybrid Fragaria vesca gene10845-v1.0-hybrid I 0.000
gene11086-v1.0-hybrid Fragaria vesca gene11086-v1.0-hybrid I 0.000
gene11440-v1.0-hybrid Fragaria vesca gene11440-v1.0-hybrid I 0.000
gene11441-v1.0-hybrid Fragaria vesca gene11441-v1.0-hybrid I 0.000
gene11442-v1.0-hybrid Fragaria vesca gene11442-v1.0-hybrid I 0.000
gene16619-v1.0-hybrid Fragaria vesca gene16619-v1.0-hybrid I 0.000
gene18922-v1.0-hybrid Fragaria vesca gene18922-v1.0-hybrid I 0.000
gene21165-v1.0-hybrid Fragaria vesca gene21165-v1.0-hybrid I 0.000
gene21166-v1.0-hybrid Fragaria vesca gene21166-v1.0-hybrid I 0.000
gene21167-v1.0-hybrid Fragaria vesca gene21167-v1.0-hybrid I 0.000
gene22175-v1.0-hybrid Fragaria vesca gene22175-v1.0-hybrid I 0.000
gene22872-v1.0-hybrid Fragaria vesca gene22872-v1.0-hybrid I 0.000
gene24044-v1.0-hybrid Fragaria vesca gene24044-v1.0-hybrid I 0.000
gene28067-v1.0-hybrid Fragaria vesca gene28067-v1.0-hybrid I 0.000
gene29738-v1.0-hybrid Fragaria vesca gene29738-v1.0-hybrid I 0.000
GLYMA01G03110 Glycine max GLYMA01G03110 I 0.000
GLYMA01G41520 Glycine max GLYMA01G41520 I 0.000
GLYMA02G00890 Glycine max GLYMA02G00890 I 0.000
GLYMA02G01960 Glycine max GLYMA02G01960 I 0.000
GLYMA02G04460 Glycine max GLYMA02G04460 I 0.000
GLYMA02G07460 Glycine max GLYMA02G07460 I 0.000
GLYMA03G26310 Glycine max GLYMA03G26310 I 0.000
GLYMA03G26394 Glycine max GLYMA03G26394 I 0.000
GLYMA03G26437 Glycine max GLYMA03G26437 I 0.000
GLYMA03G26480 Glycine max GLYMA03G26480 I 0.000
GLYMA03G26520 Glycine max GLYMA03G26520 I 0.000
GLYMA03G26530 Glycine max GLYMA03G26530 I 0.000
GLYMA03G31930 Glycine max GLYMA03G31930 I 0.000
GLYMA03G42450 Glycine max GLYMA03G42450 I 0.000
GLYMA05G05130 Glycine max GLYMA05G05130 I 0.000
GLYMA05G05180 Glycine max GLYMA05G05180 I 0.000
GLYMA07G04950 Glycine max GLYMA07G04950 I 0.000
GLYMA07G13980 Glycine max GLYMA07G13980 I 0.000
GLYMA07G37410 Glycine max GLYMA07G37410 I 0.000
GLYMA07G37990 Glycine max GLYMA07G37990 I 0.000
GLYMA08G38800 Glycine max GLYMA08G38800 I 0.000
GLYMA10G00980 Glycine max GLYMA10G00980 I 0.000
GLYMA10G00990 Glycine max GLYMA10G00990 I 0.000
GLYMA10G02080 Glycine max GLYMA10G02080 I 0.000
GLYMA10G04160 Glycine max GLYMA10G04160 I 0.000
GLYMA10G04190 Glycine max GLYMA10G04190 I 0.000
GLYMA10G23440 Glycine max GLYMA10G23440 I 0.000
GLYMA10G23460 Glycine max GLYMA10G23460 I 0.000
GLYMA10G33060 Glycine max GLYMA10G33060 I 0.000
GLYMA10G33070 Glycine max GLYMA10G33070 I 0.000
GLYMA10G33080 Glycine max GLYMA10G33080 I 0.000
GLYMA10G33810 Glycine max GLYMA10G33810 I 0.000
GLYMA11G03900 Glycine max GLYMA11G03900 I 0.000
GLYMA11G03910 Glycine max GLYMA11G03910 I 0.000
GLYMA13G18330 Glycine max GLYMA13G18330 I 0.000
GLYMA13G18400 Glycine max GLYMA13G18400 I 0.000
GLYMA13G30710 Glycine max GLYMA13G30710 I 0.000
GLYMA13G30720 Glycine max GLYMA13G30720 I 0.000
GLYMA13G30990 Glycine max GLYMA13G30990 I 0.000
GLYMA15G08370 Glycine max GLYMA15G08370 I 0.000
GLYMA15G08560 Glycine max GLYMA15G08560 I 0.000
GLYMA15G08580 Glycine max GLYMA15G08580 I 0.000
GLYMA16G01500 Glycine max GLYMA16G01500 I 0.000
GLYMA16G05070 Glycine max GLYMA16G05070 I 0.000
GLYMA16G26460 Glycine max GLYMA16G26460 I 0.000
GLYMA17G02711 Glycine max GLYMA17G02711 I 0.000
GLYMA17G15460 Glycine max GLYMA17G15460 I 0.000
GLYMA17G15480 Glycine max GLYMA17G15480 I 0.000
GLYMA18G20962 Glycine max GLYMA18G20962 I 0.000
GLYMA19G34650 Glycine max GLYMA19G34650 I 0.000
GLYMA19G34670 Glycine max GLYMA19G34670 I 0.000
GLYMA19G40070 Glycine max GLYMA19G40070 I 0.000
GLYMA19G45200 Glycine max GLYMA19G45200 I 0.000
GLYMA20G16910 Glycine max GLYMA20G16910 I 0.000
GLYMA20G16920 Glycine max GLYMA20G16920 I 0.000
GLYMA20G33800 Glycine max GLYMA20G33800 I 0.000
GLYMA20G34550 Glycine max GLYMA20G34550 I 0.000
GLYMA20G34560 Glycine max GLYMA20G34560 I 0.000
GLYMA20G34570 Glycine max GLYMA20G34570 I 0.000
Gorai.001G051100 Gossypium raimondii Gorai.001G051100 I 0.000
Gorai.001G051200 Gossypium raimondii Gorai.001G051200 I 0.000
Gorai.001G051300 Gossypium raimondii Gorai.001G051300 I 0.000
Gorai.001G176600 Gossypium raimondii Gorai.001G176600 I 0.000
Gorai.001G176700 Gossypium raimondii Gorai.001G176700 I 0.000
Gorai.001G252400 Gossypium raimondii Gorai.001G252400 I 0.000
Gorai.001G252600 Gossypium raimondii Gorai.001G252600 I 0.000
Gorai.001G252700 Gossypium raimondii Gorai.001G252700 I 0.000
Gorai.001G252900 Gossypium raimondii Gorai.001G252900 I 0.000
Gorai.002G187500 Gossypium raimondii Gorai.002G187500 I 0.000
Gorai.003G112200 Gossypium raimondii Gorai.003G112200 I 0.000
Gorai.003G176200 Gossypium raimondii Gorai.003G176200 I 0.000
Gorai.004G051600 Gossypium raimondii Gorai.004G051600 I 0.000
Gorai.004G070700 Gossypium raimondii Gorai.004G070700 I 0.000
Gorai.004G142800 Gossypium raimondii Gorai.004G142800 I 0.000
Gorai.004G195000 Gossypium raimondii Gorai.004G195000 I 0.000
Gorai.004G195100 Gossypium raimondii Gorai.004G195100 I 0.000
Gorai.004G195200 Gossypium raimondii Gorai.004G195200 I 0.000
Gorai.004G195300 Gossypium raimondii Gorai.004G195300 I 0.000
Gorai.004G220800 Gossypium raimondii Gorai.004G220800 I 0.000
Gorai.005G049200 Gossypium raimondii Gorai.005G049200 I 0.000
Gorai.005G058700 Gossypium raimondii Gorai.005G058700 I 0.000
Gorai.005G177900 Gossypium raimondii Gorai.005G177900 I 0.000
Gorai.005G197800 Gossypium raimondii Gorai.005G197800 I 0.000
Gorai.005G200200 Gossypium raimondii Gorai.005G200200 I 0.000
Gorai.005G238000 Gossypium raimondii Gorai.005G238000 I 0.000
Gorai.006G088000 Gossypium raimondii Gorai.006G088000 I 0.000
Gorai.006G214100 Gossypium raimondii Gorai.006G214100 I 0.000
Gorai.006G249800 Gossypium raimondii Gorai.006G249800 I 0.000
Gorai.006G264300 Gossypium raimondii Gorai.006G264300 I 0.000
Gorai.007G046000 Gossypium raimondii Gorai.007G046000 I 0.000
Gorai.007G046100 Gossypium raimondii Gorai.007G046100 I 0.000
Gorai.007G086000 Gossypium raimondii Gorai.007G086000 I 0.000
Gorai.007G086100 Gossypium raimondii Gorai.007G086100 I 0.000
Gorai.007G145700 Gossypium raimondii Gorai.007G145700 I 0.000
Gorai.008G025100 Gossypium raimondii Gorai.008G025100 I 0.000
Gorai.008G108400 Gossypium raimondii Gorai.008G108400 I 0.000
Gorai.008G108500 Gossypium raimondii Gorai.008G108500 I 0.000
Gorai.008G108600 Gossypium raimondii Gorai.008G108600 I 0.000
Gorai.008G123400 Gossypium raimondii Gorai.008G123400 I 0.000
Gorai.008G213900 Gossypium raimondii Gorai.008G213900 I 0.000
Gorai.008G214000 Gossypium raimondii Gorai.008G214000 I 0.000
Gorai.008G219300 Gossypium raimondii Gorai.008G219300 I 0.000
Gorai.008G232500 Gossypium raimondii Gorai.008G232500 I 0.000
Gorai.008G232600 Gossypium raimondii Gorai.008G232600 I 0.000
Gorai.008G232700 Gossypium raimondii Gorai.008G232700 I 0.000
Gorai.009G147300 Gossypium raimondii Gorai.009G147300 I 0.000
Gorai.009G165400 Gossypium raimondii Gorai.009G165400 I 0.000
Gorai.009G165500 Gossypium raimondii Gorai.009G165500 I 0.000
Gorai.010G155900 Gossypium raimondii Gorai.010G155900 I 0.000
Gorai.010G156500 Gossypium raimondii Gorai.010G156500 I 0.000
Gorai.010G156600 Gossypium raimondii Gorai.010G156600 I 0.000
Gorai.010G236100 Gossypium raimondii Gorai.010G236100 I 0.000
Gorai.010G256600 Gossypium raimondii Gorai.010G256600 I 0.000
Gorai.011G029800 Gossypium raimondii Gorai.011G029800 I 0.000
Gorai.011G056300 Gossypium raimondii Gorai.011G056300 I 0.000
Gorai.011G172800 Gossypium raimondii Gorai.011G172800 I 0.000
Gorai.011G173000 Gossypium raimondii Gorai.011G173000 I 0.000
Gorai.011G188200 Gossypium raimondii Gorai.011G188200 I 0.000
Gorai.013G043700 Gossypium raimondii Gorai.013G043700 I 0.000
GRMZM2G020016 Zea mays GRMZM2G020016 I 0.000
GRMZM2G021790 Zea mays GRMZM2G021790 I 0.000
GRMZM2G024871 Zea mays GRMZM2G024871 I 0.000
GRMZM2G052667 Zea mays GRMZM2G052667 I 0.000
GRMZM2G055180 Zea mays GRMZM2G055180 I 0.000
GRMZM2G057386 Zea mays GRMZM2G057386 I 0.000
GRMZM2G060465 Zea mays GRMZM2G060465 I 0.000
GRMZM2G060517 Zea mays GRMZM2G060517 I 0.000
GRMZM2G066158 Zea mays GRMZM2G066158 I 0.000
GRMZM2G080516 Zea mays GRMZM2G080516 I 0.000
GRMZM2G085964 Zea mays GRMZM2G085964 I 0.000
GRMZM2G103085 Zea mays GRMZM2G103085 I 0.000
GRMZM2G131281 Zea mays GRMZM2G131281 I 0.000
GRMZM2G132185 Zea mays GRMZM2G132185 I 0.000
GRMZM2G148333 Zea mays GRMZM2G148333 I 0.000
GRMZM2G151542 Zea mays GRMZM2G151542 I 0.000
GRMZM2G160971 Zea mays GRMZM2G160971 I 0.000
GRMZM2G171179 Zea mays GRMZM2G171179 I 0.000
GRMZM2G307119 Zea mays GRMZM2G307119 I 0.000
GRMZM2G310368 Zea mays GRMZM2G310368 I 0.000
GRMZM2G317596 Zea mays GRMZM2G317596 I 0.000
GRMZM2G328197 Zea mays GRMZM2G328197 I 0.000
GRMZM2G369472 Zea mays GRMZM2G369472 I 0.000
GRMZM2G429378 Zea mays GRMZM2G429378 I 0.000
GRMZM2G458437 Zea mays GRMZM2G458437 I 0.000
GRMZM2G466044 Zea mays GRMZM2G466044 I 0.000
GRMZM2G474326 Zea mays GRMZM2G474326 I 0.000
GRMZM2G475678 Zea mays GRMZM2G475678 I 0.000
GRMZM5G805505 Zea mays GRMZM5G805505 I 0.000
GSMUA_Achr10G09150_001 Musa acuminata GSMUA_Achr10G09150_001 I 0.000
GSMUA_Achr10G14570_001 Musa acuminata GSMUA_Achr10G14570_001 I 0.000
GSMUA_Achr10G31090_001 Musa acuminata GSMUA_Achr10G31090_001 I 0.000
GSMUA_Achr11G15810_001 Musa acuminata GSMUA_Achr11G15810_001 I 0.000
GSMUA_Achr11G16200_001 Musa acuminata GSMUA_Achr11G16200_001 I 0.000
GSMUA_Achr11G19880_001 Musa acuminata GSMUA_Achr11G19880_001 I 0.000
GSMUA_Achr11G20930_001 Musa acuminata GSMUA_Achr11G20930_001 I 0.000
GSMUA_Achr1G00480_001 Musa acuminata GSMUA_Achr1G00480_001 I 0.000
GSMUA_Achr1G00490_001 Musa acuminata GSMUA_Achr1G00490_001 I 0.000
GSMUA_Achr1G01380_001 Musa acuminata GSMUA_Achr1G01380_001 I 0.000
GSMUA_Achr1G15350_001 Musa acuminata GSMUA_Achr1G15350_001 I 0.000
GSMUA_Achr2G10490_001 Musa acuminata GSMUA_Achr2G10490_001 I 0.000
GSMUA_Achr3G05800_001 Musa acuminata GSMUA_Achr3G05800_001 I 0.000
GSMUA_Achr3G08180_001 Musa acuminata GSMUA_Achr3G08180_001 I 0.000
GSMUA_Achr3G10140_001 Musa acuminata GSMUA_Achr3G10140_001 I 0.000
GSMUA_Achr3G15550_001 Musa acuminata GSMUA_Achr3G15550_001 I 0.000
GSMUA_Achr3G23710_001 Musa acuminata GSMUA_Achr3G23710_001 I 0.000
GSMUA_Achr4G05510_001 Musa acuminata GSMUA_Achr4G05510_001 I 0.000
GSMUA_Achr4G12070_001 Musa acuminata GSMUA_Achr4G12070_001 I 0.000
GSMUA_Achr4G16600_001 Musa acuminata GSMUA_Achr4G16600_001 I 0.000
GSMUA_Achr4G23620_001 Musa acuminata GSMUA_Achr4G23620_001 I 0.000
GSMUA_Achr4G33270_001 Musa acuminata GSMUA_Achr4G33270_001 I 0.000
GSMUA_Achr5G12530_001 Musa acuminata GSMUA_Achr5G12530_001 I 0.000
GSMUA_Achr5G21050_001 Musa acuminata GSMUA_Achr5G21050_001 I 0.000
GSMUA_Achr5G24060_001 Musa acuminata GSMUA_Achr5G24060_001 I 0.000
GSMUA_Achr5G24680_001 Musa acuminata GSMUA_Achr5G24680_001 I 0.000
GSMUA_Achr5G27850_001 Musa acuminata GSMUA_Achr5G27850_001 I 0.000
GSMUA_Achr6G00250_001 Musa acuminata GSMUA_Achr6G00250_001 I 0.000
GSMUA_Achr6G04440_001 Musa acuminata GSMUA_Achr6G04440_001 I 0.000
GSMUA_Achr6G10870_001 Musa acuminata GSMUA_Achr6G10870_001 I 0.000
GSMUA_Achr6G32030_001 Musa acuminata GSMUA_Achr6G32030_001 I 0.000
GSMUA_Achr7G00350_001 Musa acuminata GSMUA_Achr7G00350_001 I 0.000
GSMUA_Achr7G03640_001 Musa acuminata GSMUA_Achr7G03640_001 I 0.000
GSMUA_Achr7G06910_001 Musa acuminata GSMUA_Achr7G06910_001 I 0.000
GSMUA_Achr7G21980_001 Musa acuminata GSMUA_Achr7G21980_001 I 0.000
GSMUA_Achr8G03550_001 Musa acuminata GSMUA_Achr8G03550_001 I 0.000
GSMUA_Achr8G06870_001 Musa acuminata GSMUA_Achr8G06870_001 I 0.000
GSMUA_Achr8G08000_001 Musa acuminata GSMUA_Achr8G08000_001 I 0.000
GSMUA_Achr8G15820_001 Musa acuminata GSMUA_Achr8G15820_001 I 0.000
GSMUA_Achr8G22500_001 Musa acuminata GSMUA_Achr8G22500_001 I 0.000
GSMUA_Achr8G23730_001 Musa acuminata GSMUA_Achr8G23730_001 I 0.000
GSMUA_Achr8G30180_001 Musa acuminata GSMUA_Achr8G30180_001 I 0.000
GSMUA_Achr9G05260_001 Musa acuminata GSMUA_Achr9G05260_001 I 0.000
GSMUA_Achr9G11480_001 Musa acuminata GSMUA_Achr9G11480_001 I 0.000
GSMUA_Achr9G18090_001 Musa acuminata GSMUA_Achr9G18090_001 I 0.000
gw1.13.222.1 Physcomitrella patens gw1.13.222.1 I 0.000
gw1.2.361.1 Physcomitrella patens gw1.2.361.1 I 0.000
gw1.25.154.1 Physcomitrella patens gw1.25.154.1 I 0.000
gw1.37.164.1 Physcomitrella patens gw1.37.164.1 I 0.000
LjSGA_028626.1 Lotus japonicus LjSGA_028626.1 I 0.000
LjSGA_146586.1 Lotus japonicus LjSGA_146586.1 I 0.000
LjT18C07.30.nc Lotus japonicus LjT18C07.30.nc I 0.000
LjT33A04.100.nc Lotus japonicus LjT33A04.100.nc I 0.000
LOC_Os08g36920 Oryza sativa LOC_Os08g36920 D 0.000
LPERR01G21530 Leersia perrieri LPERR01G21530 I 0.000
LPERR01G29260 Leersia perrieri LPERR01G29260 I 0.000
LPERR02G21460 Leersia perrieri LPERR02G21460 I 0.000
LPERR02G21480 Leersia perrieri LPERR02G21480 I 0.000
LPERR02G27530 Leersia perrieri LPERR02G27530 I 0.000
LPERR03G03540 Leersia perrieri LPERR03G03540 I 0.000
LPERR03G05400 Leersia perrieri LPERR03G05400 I 0.000
LPERR03G35710 Leersia perrieri LPERR03G35710 I 0.000
LPERR04G03550 Leersia perrieri LPERR04G03550 I 0.000
LPERR04G16740 Leersia perrieri LPERR04G16740 I 0.000
LPERR05G10570 Leersia perrieri LPERR05G10570 I 0.000
LPERR05G17480 Leersia perrieri LPERR05G17480 I 0.000
LPERR05G21530 Leersia perrieri LPERR05G21530 I 0.000
LPERR07G22580 Leersia perrieri LPERR07G22580 I 0.000
LPERR09G09240 Leersia perrieri LPERR09G09240 I 0.000
LPERR09G16370 Leersia perrieri LPERR09G16370 I 0.000
LPERR10G08470 Leersia perrieri LPERR10G08470 I 0.000
LPERR10G14500 Leersia perrieri LPERR10G14500 I 0.000
Lus10003562.g Linum usitatissimum Lus10003562.g I 0.000
Lus10003601.g Linum usitatissimum Lus10003601.g I 0.000
Lus10004368.g Linum usitatissimum Lus10004368.g I 0.000
Lus10004752.g Linum usitatissimum Lus10004752.g I 0.000
Lus10005281.g Linum usitatissimum Lus10005281.g I 0.000
Lus10005285.g Linum usitatissimum Lus10005285.g I 0.000
Lus10006579.g Linum usitatissimum Lus10006579.g I 0.000
Lus10007841.g Linum usitatissimum Lus10007841.g I 0.000
Lus10008214.g Linum usitatissimum Lus10008214.g I 0.000
Lus10011829.g Linum usitatissimum Lus10011829.g I 0.000
Lus10011830.g Linum usitatissimum Lus10011830.g I 0.000
Lus10011831.g Linum usitatissimum Lus10011831.g I 0.000
Lus10013186.g Linum usitatissimum Lus10013186.g I 0.000
Lus10013958.g Linum usitatissimum Lus10013958.g I 0.000
Lus10013959.g Linum usitatissimum Lus10013959.g I 0.000
Lus10014054.g Linum usitatissimum Lus10014054.g I 0.000
Lus10014655.g Linum usitatissimum Lus10014655.g I 0.000
Lus10015415.g Linum usitatissimum Lus10015415.g I 0.000
Lus10016211.g Linum usitatissimum Lus10016211.g I 0.000
Lus10018623.g Linum usitatissimum Lus10018623.g I 0.000
Lus10021193.g Linum usitatissimum Lus10021193.g I 0.000
Lus10021196.g Linum usitatissimum Lus10021196.g I 0.000
Lus10022936.g Linum usitatissimum Lus10022936.g I 0.000
Lus10024883.g Linum usitatissimum Lus10024883.g I 0.000
Lus10025430.g Linum usitatissimum Lus10025430.g I 0.000
Lus10032498.g Linum usitatissimum Lus10032498.g I 0.000
Lus10032499.g Linum usitatissimum Lus10032499.g I 0.000
Lus10033884.g Linum usitatissimum Lus10033884.g I 0.000
Lus10033885.g Linum usitatissimum Lus10033885.g I 0.000
Lus10033963.g Linum usitatissimum Lus10033963.g I 0.000
Lus10035129.g Linum usitatissimum Lus10035129.g I 0.000
Lus10037448.g Linum usitatissimum Lus10037448.g I 0.000
Lus10039857.g Linum usitatissimum Lus10039857.g I 0.000
Lus10042995.g Linum usitatissimum Lus10042995.g I 0.000
Lus10042996.g Linum usitatissimum Lus10042996.g I 0.000
MDP0000122665 Malus domestica MDP0000122665 I 0.000
MDP0000123172 Malus domestica MDP0000123172 I 0.000
MDP0000127134 Malus domestica MDP0000127134 I 0.000
MDP0000135205 Malus domestica MDP0000135205 I 0.000
MDP0000143745 Malus domestica MDP0000143745 I 0.000
MDP0000155543 Malus domestica MDP0000155543 I 0.000
MDP0000167207 Malus domestica MDP0000167207 I 0.000
MDP0000180950 Malus domestica MDP0000180950 I 0.000
MDP0000187369 Malus domestica MDP0000187369 I 0.000
MDP0000190504 Malus domestica MDP0000190504 I 0.000
MDP0000235313 Malus domestica MDP0000235313 I 0.000
MDP0000240840 Malus domestica MDP0000240840 I 0.000
MDP0000254227 Malus domestica MDP0000254227 I 0.000
MDP0000263008 Malus domestica MDP0000263008 I 0.000
MDP0000264124 Malus domestica MDP0000264124 I 0.000
MDP0000288465 Malus domestica MDP0000288465 I 0.000
MDP0000299277 Malus domestica MDP0000299277 I 0.000
MDP0000308922 Malus domestica MDP0000308922 I 0.000
MDP0000309801 Malus domestica MDP0000309801 I 0.000
MDP0000312701 Malus domestica MDP0000312701 I 0.000
MDP0000315533 Malus domestica MDP0000315533 I 0.000
MDP0000324718 Malus domestica MDP0000324718 I 0.000
MDP0000403580 Malus domestica MDP0000403580 I 0.000
MDP0000413387 Malus domestica MDP0000413387 I 0.000
MDP0000430682 Malus domestica MDP0000430682 I 0.000
MDP0000467753 Malus domestica MDP0000467753 I 0.000
MDP0000517257 Malus domestica MDP0000517257 I 0.000
MDP0000517262 Malus domestica MDP0000517262 I 0.000
MDP0000665685 Malus domestica MDP0000665685 I 0.000
MDP0000689946 Malus domestica MDP0000689946 I 0.000
MDP0000755622 Malus domestica MDP0000755622 I 0.000
MDP0000778140 Malus domestica MDP0000778140 I 0.000
MDP0000787281 Malus domestica MDP0000787281 I 0.000
MDP0000789227 Malus domestica MDP0000789227 I 0.000
MDP0000791464 Malus domestica MDP0000791464 I 0.000
MDP0000805422 Malus domestica MDP0000805422 I 0.000
MDP0000880063 Malus domestica MDP0000880063 I 0.000
MDP0000923579 Malus domestica MDP0000923579 I 0.000
mgf001695m Mimulus guttatus mgf001695m I 0.000
mgf002457m Mimulus guttatus mgf002457m I 0.000
mgf017485m Mimulus guttatus mgf017485m I 0.000
mgf018792m Mimulus guttatus mgf018792m I 0.000
mgf018935m Mimulus guttatus mgf018935m I 0.000
mgf019214m Mimulus guttatus mgf019214m I 0.000
mgf019421m Mimulus guttatus mgf019421m I 0.000
mgf019541m Mimulus guttatus mgf019541m I 0.000
mgf019807m Mimulus guttatus mgf019807m I 0.000
mgf019903m Mimulus guttatus mgf019903m I 0.000
mgf020623m Mimulus guttatus mgf020623m I 0.000
mgf020878m Mimulus guttatus mgf020878m I 0.000
mgf021067m Mimulus guttatus mgf021067m I 0.000
mgf021081m Mimulus guttatus mgf021081m I 0.000
mgf021215m Mimulus guttatus mgf021215m I 0.000
mgf021650m Mimulus guttatus mgf021650m I 0.000
mgf021756m Mimulus guttatus mgf021756m I 0.000
mgf021944m Mimulus guttatus mgf021944m I 0.000
mgf023248m Mimulus guttatus mgf023248m I 0.000
mgf023779m Mimulus guttatus mgf023779m I 0.000
mgf025885m Mimulus guttatus mgf025885m I 0.000
mgf026054m Mimulus guttatus mgf026054m I 0.000
MLOC_10225 Hordeum vulgare MLOC_10225 I 0.000
MLOC_18529 Hordeum vulgare MLOC_18529 I 0.000
MLOC_238 Hordeum vulgare MLOC_238 I 0.000
MLOC_24530 Hordeum vulgare MLOC_24530 I 0.000
MLOC_64636 Hordeum vulgare MLOC_64636 I 0.000
MLOC_69987 Hordeum vulgare MLOC_69987 I 0.000
MLOC_70692 Hordeum vulgare MLOC_70692 I 0.000
MLOC_73358 Hordeum vulgare MLOC_73358 I 0.000
MTR_1g040430 Medicago truncatula MTR_1g040430 I 0.000
MTR_1g043350 Medicago truncatula MTR_1g043350 I 0.000
MTR_1g048610 Medicago truncatula MTR_1g048610 I 0.000
MTR_1g069960 Medicago truncatula MTR_1g069960 I 0.000
MTR_1g070070 Medicago truncatula MTR_1g070070 I 0.000
MTR_1g074230 Medicago truncatula MTR_1g074230 I 0.000
MTR_1g074250 Medicago truncatula MTR_1g074250 I 0.000
MTR_1g074310 Medicago truncatula MTR_1g074310 I 0.000
MTR_1g087920 Medicago truncatula MTR_1g087920 I 0.000
MTR_1g090290 Medicago truncatula MTR_1g090290 I 0.000
MTR_2g014340 Medicago truncatula MTR_2g014340 I 0.000
MTR_2g015040 Medicago truncatula MTR_2g015040 I 0.000
MTR_2g015050 Medicago truncatula MTR_2g015050 I 0.000
MTR_2g078680 Medicago truncatula MTR_2g078680 I 0.000
MTR_2g105380 Medicago truncatula MTR_2g105380 I 0.000
MTR_4g054360 Medicago truncatula MTR_4g054360 I 0.000
MTR_4g054740 Medicago truncatula MTR_4g054740 I 0.000
MTR_4g054860 Medicago truncatula MTR_4g054860 I 0.000
MTR_4g078710 Medicago truncatula MTR_4g078710 I 0.000
MTR_4g086220 Medicago truncatula MTR_4g086220 I 0.000
MTR_4g088005 Medicago truncatula MTR_4g088005 I 0.000
MTR_4g100380 Medicago truncatula MTR_4g100380 I 0.000
MTR_4g100420 Medicago truncatula MTR_4g100420 I 0.000
MTR_4g100450 Medicago truncatula MTR_4g100450 I 0.000
MTR_4g119270 Medicago truncatula MTR_4g119270 I 0.000
MTR_5g032820 Medicago truncatula MTR_5g032820 I 0.000
MTR_7g021010 Medicago truncatula MTR_7g021010 I 0.000
MTR_7g081795 Medicago truncatula MTR_7g081795 I 0.000
MTR_7g084370 Medicago truncatula MTR_7g084370 I 0.000
MTR_7g096700 Medicago truncatula MTR_7g096700 I 0.000
MTR_7g096750 Medicago truncatula MTR_7g096750 I 0.000
MTR_7g096810 Medicago truncatula MTR_7g096810 I 0.000
MTR_8g006825 Medicago truncatula MTR_8g006825 I 0.000
MTR_8g022820 Medicago truncatula MTR_8g022820 I 0.000
OB01G34420 Oryza brachyantha OB01G34420 I 0.000
OB01G42720 Oryza brachyantha OB01G42720 I 0.000
OB03G13950 Oryza brachyantha OB03G13950 I 0.000
OB04G14270 Oryza brachyantha OB04G14270 I 0.000
OB04G27680 Oryza brachyantha OB04G27680 I 0.000
OB05G21350 Oryza brachyantha OB05G21350 I 0.000
OB05G33440 Oryza brachyantha OB05G33440 I 0.000
OB08G25030 Oryza brachyantha OB08G25030 I 0.000
OB09G19290 Oryza brachyantha OB09G19290 I 0.000
OB09G27120 Oryza brachyantha OB09G27120 I 0.000
OB10G18940 Oryza brachyantha OB10G18940 I 0.000
OBART01G25240 Oryza barthii OBART01G25240 I 0.000
OBART01G33870 Oryza barthii OBART01G33870 I 0.000
OBART02G26470 Oryza barthii OBART02G26470 I 0.000
OBART03G03890 Oryza barthii OBART03G03890 I 0.000
OBART03G06060 Oryza barthii OBART03G06060 I 0.000
OBART03G41810 Oryza barthii OBART03G41810 I 0.000
OBART04G05450 Oryza barthii OBART04G05450 I 0.000
OBART04G20640 Oryza barthii OBART04G20640 I 0.000
OBART05G13390 Oryza barthii OBART05G13390 I 0.000
OBART05G21580 Oryza barthii OBART05G21580 I 0.000
OBART05G25910 Oryza barthii OBART05G25910 I 0.000
OBART07G25780 Oryza barthii OBART07G25780 I 0.000
OBART09G12810 Oryza barthii OBART09G12810 I 0.000
OBART09G20380 Oryza barthii OBART09G20380 I 0.000
OBART10G11630 Oryza barthii OBART10G11630 I 0.000
OBART10G18670 Oryza barthii OBART10G18670 I 0.000
OGLUM01G29010 Oryza glumaepatula OGLUM01G29010 I 0.000
OGLUM01G38110 Oryza glumaepatula OGLUM01G38110 I 0.000
OGLUM02G26840 Oryza glumaepatula OGLUM02G26840 I 0.000
OGLUM02G26870 Oryza glumaepatula OGLUM02G26870 I 0.000
OGLUM03G03790 Oryza glumaepatula OGLUM03G03790 I 0.000
OGLUM03G06060 Oryza glumaepatula OGLUM03G06060 I 0.000
OGLUM03G41640 Oryza glumaepatula OGLUM03G41640 I 0.000
OGLUM04G04620 Oryza glumaepatula OGLUM04G04620 I 0.000
OGLUM04G20600 Oryza glumaepatula OGLUM04G20600 I 0.000
OGLUM04G20610 Oryza glumaepatula OGLUM04G20610 I 0.000
OGLUM05G14230 Oryza glumaepatula OGLUM05G14230 I 0.000
OGLUM05G22790 Oryza glumaepatula OGLUM05G22790 I 0.000
OGLUM05G27510 Oryza glumaepatula OGLUM05G27510 I 0.000
OGLUM07G25800 Oryza glumaepatula OGLUM07G25800 I 0.000
OGLUM08G18720 Oryza glumaepatula OGLUM08G18720 I 0.000
OGLUM09G13230 Oryza glumaepatula OGLUM09G13230 I 0.000
OGLUM09G21140 Oryza glumaepatula OGLUM09G21140 I 0.000
OGLUM10G11380 Oryza glumaepatula OGLUM10G11380 I 0.000
OLONG_002067 Oryza longistaminata OLONG_002067 I 0.000
OLONG_003671 Oryza longistaminata OLONG_003671 I 0.000
OLONG_005596 Oryza longistaminata OLONG_005596 I 0.000
OLONG_008277 Oryza longistaminata OLONG_008277 I 0.000
OLONG_013554 Oryza longistaminata OLONG_013554 I 0.000
OLONG_021733 Oryza longistaminata OLONG_021733 I 0.000
OLONG_027600 Oryza longistaminata OLONG_027600 I 0.000
OMERI01G22970 Oryza meridionalis OMERI01G22970 I 0.000
OMERI01G28260 Oryza meridionalis OMERI01G28260 I 0.000
OMERI01G30710 Oryza meridionalis OMERI01G30710 I 0.000
OMERI02G25760 Oryza meridionalis OMERI02G25760 I 0.000
OMERI03G03710 Oryza meridionalis OMERI03G03710 I 0.000
OMERI03G05890 Oryza meridionalis OMERI03G05890 I 0.000
OMERI03G15490 Oryza meridionalis OMERI03G15490 I 0.000
OMERI03G30010 Oryza meridionalis OMERI03G30010 I 0.000
OMERI04G17100 Oryza meridionalis OMERI04G17100 I 0.000
OMERI04G17110 Oryza meridionalis OMERI04G17110 I 0.000
OMERI05G19490 Oryza meridionalis OMERI05G19490 I 0.000
OMERI07G22420 Oryza meridionalis OMERI07G22420 I 0.000
OMERI08G00270 Oryza meridionalis OMERI08G00270 I 0.000
OMERI09G10200 Oryza meridionalis OMERI09G10200 I 0.000
ONIVA01G28490 Oryza nivara ONIVA01G28490 I 0.000
ONIVA01G35550 Oryza nivara ONIVA01G35550 I 0.000
ONIVA01G38670 Oryza nivara ONIVA01G38670 I 0.000
ONIVA01G39370 Oryza nivara ONIVA01G39370 I 0.000
ONIVA01G48030 Oryza nivara ONIVA01G48030 I 0.000
ONIVA02G20420 Oryza nivara ONIVA02G20420 I 0.000
ONIVA02G28810 Oryza nivara ONIVA02G28810 I 0.000
ONIVA02G28840 Oryza nivara ONIVA02G28840 I 0.000
ONIVA03G03670 Oryza nivara ONIVA03G03670 I 0.000
ONIVA03G06080 Oryza nivara ONIVA03G06080 I 0.000
ONIVA03G20710 Oryza nivara ONIVA03G20710 I 0.000
ONIVA04G03680 Oryza nivara ONIVA04G03680 I 0.000
ONIVA04G18900 Oryza nivara ONIVA04G18900 I 0.000
ONIVA04G18910 Oryza nivara ONIVA04G18910 I 0.000
ONIVA05G14090 Oryza nivara ONIVA05G14090 I 0.000
ONIVA05G22270 Oryza nivara ONIVA05G22270 I 0.000
ONIVA05G27810 Oryza nivara ONIVA05G27810 I 0.000
ONIVA07G25390 Oryza nivara ONIVA07G25390 I 0.000
ONIVA08G19930 Oryza nivara ONIVA08G19930 I 0.000
ONIVA10G10810 Oryza nivara ONIVA10G10810 I 0.000
OPUNC01G30160 Oryza punctata OPUNC01G30160 I 0.000
OPUNC01G32930 Oryza punctata OPUNC01G32930 I 0.000
OPUNC02G24070 Oryza punctata OPUNC02G24070 I 0.000
OPUNC02G24090 Oryza punctata OPUNC02G24090 I 0.000
OPUNC03G03600 Oryza punctata OPUNC03G03600 I 0.000
OPUNC04G18300 Oryza punctata OPUNC04G18300 I 0.000
OPUNC04G18310 Oryza punctata OPUNC04G18310 I 0.000
OPUNC04G18320 Oryza punctata OPUNC04G18320 I 0.000
OPUNC05G11600 Oryza punctata OPUNC05G11600 I 0.000
OPUNC05G19230 Oryza punctata OPUNC05G19230 I 0.000
OPUNC05G23490 Oryza punctata OPUNC05G23490 I 0.000
OPUNC07G24180 Oryza punctata OPUNC07G24180 I 0.000
OPUNC08G15760 Oryza punctata OPUNC08G15760 I 0.000
OPUNC09G11150 Oryza punctata OPUNC09G11150 I 0.000
OPUNC09G18680 Oryza punctata OPUNC09G18680 I 0.000
OPUNC10G09910 Oryza punctata OPUNC10G09910 I 0.000
OPUNC10G17040 Oryza punctata OPUNC10G17040 I 0.000
orange1.1g019887m.g Citrus sinensis orange1.1g019887m.g I 0.000
orange1.1g023209m.g Citrus sinensis orange1.1g023209m.g I 0.000
orange1.1g026240m.g Citrus sinensis orange1.1g026240m.g I 0.000
orange1.1g026385m.g Citrus sinensis orange1.1g026385m.g I 0.000
orange1.1g028566m.g Citrus sinensis orange1.1g028566m.g I 0.000
orange1.1g030002m.g Citrus sinensis orange1.1g030002m.g I 0.000
orange1.1g031071m.g Citrus sinensis orange1.1g031071m.g I 0.000
orange1.1g037093m.g Citrus sinensis orange1.1g037093m.g I 0.000
orange1.1g037347m.g Citrus sinensis orange1.1g037347m.g I 0.000
orange1.1g039409m.g Citrus sinensis orange1.1g039409m.g I 0.000
orange1.1g039729m.g Citrus sinensis orange1.1g039729m.g I 0.000
orange1.1g043029m.g Citrus sinensis orange1.1g043029m.g I 0.000
orange1.1g043184m.g Citrus sinensis orange1.1g043184m.g I 0.000
orange1.1g043400m.g Citrus sinensis orange1.1g043400m.g I 0.000
orange1.1g044016m.g Citrus sinensis orange1.1g044016m.g I 0.000
orange1.1g044938m.g Citrus sinensis orange1.1g044938m.g I 0.000
orange1.1g046538m.g Citrus sinensis orange1.1g046538m.g I 0.000
orange1.1g047241m.g Citrus sinensis orange1.1g047241m.g I 0.000
orange1.1g047334m.g Citrus sinensis orange1.1g047334m.g I 0.000
orange1.1g048608m.g Citrus sinensis orange1.1g048608m.g I 0.000
ORGLA01G0205500 Oryza glaberrima ORGLA01G0205500 I 0.000
ORGLA01G0278100 Oryza glaberrima ORGLA01G0278100 I 0.000
ORGLA02G0226500 Oryza glaberrima ORGLA02G0226500 I 0.000
ORGLA02G0226700 Oryza glaberrima ORGLA02G0226700 I 0.000
ORGLA03G0036700 Oryza glaberrima ORGLA03G0036700 I 0.000
ORGLA03G0058500 Oryza glaberrima ORGLA03G0058500 I 0.000
ORGLA03G0387300 Oryza glaberrima ORGLA03G0387300 I 0.000
ORGLA04G0041100 Oryza glaberrima ORGLA04G0041100 I 0.000
ORGLA04G0177100 Oryza glaberrima ORGLA04G0177100 I 0.000
ORGLA04G0177200 Oryza glaberrima ORGLA04G0177200 I 0.000
ORGLA04G0177300 Oryza glaberrima ORGLA04G0177300 I 0.000
ORGLA05G0114900 Oryza glaberrima ORGLA05G0114900 I 0.000
ORGLA05G0187600 Oryza glaberrima ORGLA05G0187600 I 0.000
ORGLA05G0224000 Oryza glaberrima ORGLA05G0224000 I 0.000
ORGLA07G0201100 Oryza glaberrima ORGLA07G0201100 I 0.000
ORGLA09G0098000 Oryza glaberrima ORGLA09G0098000 I 0.000
ORGLA09G0166700 Oryza glaberrima ORGLA09G0166700 I 0.000
ORGLA10G0102500 Oryza glaberrima ORGLA10G0102500 I 0.000
ORGLA10G0138000 Oryza glaberrima ORGLA10G0138000 I 0.000
ORUFI01G28060 Oryza rufipogon ORUFI01G28060 I 0.000
ORUFI01G34250 Oryza rufipogon ORUFI01G34250 I 0.000
ORUFI01G37120 Oryza rufipogon ORUFI01G37120 I 0.000
ORUFI02G27830 Oryza rufipogon ORUFI02G27830 I 0.000
ORUFI02G27860 Oryza rufipogon ORUFI02G27860 I 0.000
ORUFI03G03630 Oryza rufipogon ORUFI03G03630 I 0.000
ORUFI03G05890 Oryza rufipogon ORUFI03G05890 I 0.000
ORUFI03G43580 Oryza rufipogon ORUFI03G43580 I 0.000
ORUFI04G06330 Oryza rufipogon ORUFI04G06330 I 0.000
ORUFI04G22230 Oryza rufipogon ORUFI04G22230 I 0.000
ORUFI04G22240 Oryza rufipogon ORUFI04G22240 I 0.000
ORUFI04G22260 Oryza rufipogon ORUFI04G22260 I 0.000
ORUFI05G14490 Oryza rufipogon ORUFI05G14490 I 0.000
ORUFI05G22850 Oryza rufipogon ORUFI05G22850 I 0.000
ORUFI05G27790 Oryza rufipogon ORUFI05G27790 I 0.000
ORUFI07G26720 Oryza rufipogon ORUFI07G26720 I 0.000
ORUFI09G13770 Oryza rufipogon ORUFI09G13770 I 0.000
ORUFI09G22030 Oryza rufipogon ORUFI09G22030 I 0.000
ORUFI10G12140 Oryza rufipogon ORUFI10G12140 I 0.000
OS01G0657400 Oryza sativa OS01G0657400 I 0.000
OS01G0752500 Oryza sativa OS01G0752500 I 0.000
OS01G0797600 Oryza sativa OS01G0797600 I 0.000
OS02G0654700 Oryza sativa OS02G0654700 I 0.000
OS03G0150200 Oryza sativa OS03G0150200 I 0.000
OS03G0183000 Oryza sativa OS03G0183000 I 0.000
OS03G0860100 Oryza sativa OS03G0860100 I 0.000
OS04G0257500 Oryza sativa OS04G0257500 I 0.000
OS04G0546800 Oryza sativa OS04G0546800 I 0.000
OS04G0547600 Oryza sativa OS04G0547600 I 0.000
OS05G0361700 Oryza sativa OS05G0361700 I 0.000
OS05G0497300 Oryza sativa OS05G0497300 I 0.000
OS07G0669500 Oryza sativa OS07G0669500 I 0.000
OS08G0474000 Oryza sativa OS08G0474000 I 0.000
OS09G0457900 Oryza sativa OS09G0457900 I 0.000
OS09G0571700 Oryza sativa OS09G0571700 I 0.000
Pavir.Aa01181 Panicum virgatum Pavir.Aa01181 I 0.000
Pavir.Aa01184 Panicum virgatum Pavir.Aa01184 I 0.000
Pavir.Ab02473 Panicum virgatum Pavir.Ab02473 I 0.000
Pavir.Ab02556 Panicum virgatum Pavir.Ab02556 I 0.000
Pavir.Ba00192 Panicum virgatum Pavir.Ba00192 I 0.000
Pavir.Ba00410 Panicum virgatum Pavir.Ba00410 I 0.000
Pavir.Bb01308 Panicum virgatum Pavir.Bb01308 I 0.000
Pavir.Bb03337 Panicum virgatum Pavir.Bb03337 I 0.000
Pavir.Ca00939 Panicum virgatum Pavir.Ca00939 I 0.000
Pavir.Ca01358 Panicum virgatum Pavir.Ca01358 I 0.000
Pavir.Cb01365 Panicum virgatum Pavir.Cb01365 I 0.000
Pavir.Db02131 Panicum virgatum Pavir.Db02131 I 0.000
Pavir.Ea02288 Panicum virgatum Pavir.Ea02288 I 0.000
Pavir.Ea03031 Panicum virgatum Pavir.Ea03031 I 0.000
Pavir.Ea03147 Panicum virgatum Pavir.Ea03147 I 0.000
Pavir.Eb01758 Panicum virgatum Pavir.Eb01758 I 0.000
Pavir.Eb03148 Panicum virgatum Pavir.Eb03148 I 0.000