Bra037320 (Brassica rapa)
Sox

TF Information

Pfam ID Interpro ID Gene ID CIS-BP ID Sequence source Animal TF db
PF00505 (HMG_box) IPR000910 Bra037320 T326720_2.00 Ensembl (2018-Dec-8) Link out

Directly determined binding motifs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
No direct experiments

Motifs from related TFs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
YAB1
M00890_2.00
Arabidopsis thaliana
AATAATWA

TWATTATT
PBM
Franco-Zorrilla et al.(2014)
YAB1
0.741 1.000
YAB5
M02486_2.00
Arabidopsis thaliana
NNNNHRN

NYDNNNN
PBM
Weirauch et al.(2014)
pTH7575
0.707 0.932
YAB5
M00889_2.00
Arabidopsis thaliana
NATRATTADNNN

NNNHTAATYATN
PBM
Franco-Zorrilla et al.(2014)
YAB5
0.707 0.932
CRC
M07266_2.00
Arabidopsis thaliana
TWATCATW

WATGATWA
Dap-seq
OMalley et al.(2016)
CRC_col_a
0.660 0.705
CRC
M07267_2.00
Arabidopsis thaliana
GGTTAGTGTTTTGGAGTCGAATATGACTTG

CAAGTCATATTCGACTCCAAAACACTAACC
Dap-seq
OMalley et al.(2016)
CRC_colamp_a
0.660 0.705
INO
M02485_2.00
Arabidopsis thaliana
NHNNNYRNNN

NNNYRNNNDN
PBM
Weirauch et al.(2014)
pTH7516
0.596 0.750
For this family, TFs with SR scores > 0.415 will likely have a similar motif

DNA Binding Domains

Protein ID Domain From To Sequence
Bra037320.1-P Sox 151 194

Links

Other Sox family TFs
Other Brassica rapa TFs

531 Related TFs

Name Species Gene ID Motif Evidence SR
Score
Action
30138.m004071 Ricinus communis 30138.m004071 I 0.000
AC207342.3_FG001 Zea mays AC207342.3_FG001 N 0.000
AMTR_s00021p00218190 Amborella trichopoda AMTR_s00021p00218190 N 0.000
AMTR_s00057p00091350 Amborella trichopoda AMTR_s00057p00091350 I 0.000
BGIOSGA001434 Oryza indica BGIOSGA001434 N 0.000
BGIOSGA022580 Oryza indica BGIOSGA022580 I 0.000
Bo9g108730 Brassica oleracea Bo9g108730 N 0.000
Bra003088 Brassica rapa Bra003088 N 0.000
BRADI2G40920 Brachypodium distachyon BRADI2G40920 N 0.000
BRADI2G61760 Brachypodium distachyon BRADI2G61760 N 0.000
Ca_13151 Cicer arietinum Ca_13151 I 0.000
chr4.CM0087.990.nc Lotus japonicus chr4.CM0087.990.nc I 0.000
F775_03178 Aegilops tauschii F775_03178 N 0.000
F775_07483 Aegilops tauschii F775_07483 I 0.000
fgenesh1_pg.scaffold_823000001 Physcomitrella patens fgenesh1_pg.scaffold_823000001 N 0.000
GRMZM2G071322 Zea mays GRMZM2G071322 N 0.000
GRMZM2G392306 Zea mays GRMZM2G392306 I 0.000
GSMUA_Achr4G08610_001 Musa acuminata GSMUA_Achr4G08610_001 N 0.000
GSMUA_AchrUn_randomG11290_001 Musa acuminata GSMUA_AchrUn_randomG11290_001 N 0.000
LPERR01G16660 Leersia perrieri LPERR01G16660 N 0.000
LPERR06G07570 Leersia perrieri LPERR06G07570 I 0.000
mg020279m Mimulus guttatus mg020279m I 0.000
MLOC_12609 Hordeum vulgare MLOC_12609 I 0.000
MLOC_59560 Hordeum vulgare MLOC_59560 I 0.000
OB06G17750 Oryza brachyantha OB06G17750 I 0.000
OBART01G19230 Oryza barthii OBART01G19230 N 0.000
OGLUM01G22860 Oryza glumaepatula OGLUM01G22860 N 0.000
OMERI06G09770 Oryza meridionalis OMERI06G09770 I 0.000
ONIVA01G21910 Oryza nivara ONIVA01G21910 N 0.000
ONIVA06G09450 Oryza nivara ONIVA06G09450 I 0.000
OPUNC01G19590 Oryza punctata OPUNC01G19590 N 0.000
OPUNC06G07940 Oryza punctata OPUNC06G07940 I 0.000
orange1.1g036926m.g Citrus sinensis orange1.1g036926m.g I 0.000
ORGLA06G0077700 Oryza glaberrima ORGLA06G0077700 I 0.000
ORUFI01G21630 Oryza rufipogon ORUFI01G21630 N 0.000
ORUFI06G08510 Oryza rufipogon ORUFI06G08510 I 0.000
OS06G0228950 Oryza sativa OS06G0228950 I 0.000
Pavir.Aa00708 Panicum virgatum Pavir.Aa00708 I 0.000
Pavir.Ab02992 Panicum virgatum Pavir.Ab02992 I 0.000
Pavir.Da01160 Panicum virgatum Pavir.Da01160 I 0.000
Pavir.Ea01492 Panicum virgatum Pavir.Ea01492 N 0.000
Pavir.J13146 Panicum virgatum Pavir.J13146 I 0.000
PDK_20s1788591g001 Phoenix dactylifera PDK_20s1788591g001 N 0.000
POPTR_0015s01410 Populus trichocarpa POPTR_0015s01410 N 0.000
Sb03g025130 Sorghum bicolor Sb03g025130 N 0.000
Sb10g008120 Sorghum bicolor Sb10g008120 I 0.000
Si005102m.g Setaria italica Si005102m.g N 0.000
Si008273m.g Setaria italica Si008273m.g I 0.000
Si020172m.g Setaria italica Si020172m.g I 0.000
Solyc03g116010.1 Solanum lycopersicum Solyc03g116010.1 I 0.000
Traes_7DS_405F08A53 Triticum aestivum Traes_7DS_405F08A53 I 0.000
TRIUR3_19503 Triticum urartu TRIUR3_19503 I 0.000