GLOINDRAFT_347422 (Rhizophagus irregularis)
Sox

TF Information

Pfam ID Interpro ID Gene ID CIS-BP ID Sequence source Animal TF db
PF00505 (HMG_box) IPR000910 GLOINDRAFT_347422 T330143_2.00 Ensembl (2018-Dec-8) Link out

Directly determined binding motifs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
No direct experiments

Motifs from related TFs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
YAB1
M00890_2.00
Arabidopsis thaliana
AATAATWA

TWATTATT
PBM
Franco-Zorrilla et al.(2014)
YAB1
0.553 0.449
CRC
M07266_2.00
Arabidopsis thaliana
TWATCATW

WATGATWA
Dap-seq
OMalley et al.(2016)
CRC_col_a
0.547 0.429
CRC
M07267_2.00
Arabidopsis thaliana
GGTTAGTGTTTTGGAGTCGAATATGACTTG

CAAGTCATATTCGACTCCAAAACACTAACC
Dap-seq
OMalley et al.(2016)
CRC_colamp_a
0.547 0.429
INO
M02485_2.00
Arabidopsis thaliana
NHNNNYRNNN

NNNYRNNNDN
PBM
Weirauch et al.(2014)
pTH7516
0.540 0.510
YAB5
M02486_2.00
Arabidopsis thaliana
NNNNHRN

NYDNNNN
PBM
Weirauch et al.(2014)
pTH7575
0.524 0.429
YAB5
M00889_2.00
Arabidopsis thaliana
NATRATTADNNN

NNNHTAATYATN
PBM
Franco-Zorrilla et al.(2014)
YAB5
0.524 0.429
For this family, TFs with SR scores > 0.415 will likely have a similar motif

DNA Binding Domains

Protein ID Domain From To Sequence
ESA12321 Sox 35 83

Links

Other Sox family TFs
Other Rhizophagus irregularis TFs

500 Related TFs

Name Species Gene ID Motif Evidence SR
Score
Action
YAB1 Arabidopsis thaliana AT2G45190 D 0.553
YAB5 Arabidopsis thaliana AT2G26580 D 0.524
CRC Arabidopsis thaliana AT1G69180 D 0.547
INO Arabidopsis thaliana AT1G23420 D 0.540
Ca_25981 Cicer arietinum Ca_25981 I 0.553
29631.m001046 Ricinus communis 29631.m001046 I 0.501
29854.m001136 Ricinus communis 29854.m001136 I 0.553
29927.m000626 Ricinus communis 29927.m000626 I 0.524
30174.m008839 Ricinus communis 30174.m008839 I 0.553
30174.m009083 Ricinus communis 30174.m009083 I 0.547
cassava10710.m1 Manihot esculenta cassava10710.m1 I 0.547
cassava13509.valid.m1 Manihot esculenta cassava13509.valid.m1 I 0.524
cassava13510.valid.m1 Manihot esculenta cassava13510.valid.m1 I 0.524
cassava13963.valid.m1 Manihot esculenta cassava13963.valid.m1 I 0.553
cassava17722.valid.m1 Manihot esculenta cassava17722.valid.m1 I 0.553
cassava26804.m1 Manihot esculenta cassava26804.m1 I 0.540
cassava27370.m1 Manihot esculenta cassava27370.m1 I 0.574
cassava30083.valid.m1 Manihot esculenta cassava30083.valid.m1 I 0.553
28200.m000191 Ricinus communis 28200.m000191 I 0.553
Pm030598 Prunus mume Pm030598 I 0.547
Cla000824 Citrullus lanatus Cla000824 I 0.545
Cla005767 Citrullus lanatus Cla005767 I 0.500
Cla008752 Citrullus lanatus Cla008752 I 0.553
Cla010239 Citrullus lanatus Cla010239 I 0.578
Cla010397 Citrullus lanatus Cla010397 I 0.547
Cla011745 Citrullus lanatus Cla011745 I 0.553
Cla012424 Citrullus lanatus Cla012424 I 0.524
Cla016962 Citrullus lanatus Cla016962 I 0.524
Pm001547 Prunus mume Pm001547 I 0.553
Pm006709 Prunus mume Pm006709 I 0.545
Pm017846 Prunus mume Pm017846 I 0.553
Pm023555 Prunus mume Pm023555 I 0.553
Pm027559 Prunus mume Pm027559 I 0.524
cassava33847.m1 Manihot esculenta cassava33847.m1 I 0.524
cassava39022.m1 Manihot esculenta cassava39022.m1 I 0.553
cassava39135.m1 Manihot esculenta cassava39135.m1 I 0.547
mgf009982m Mimulus guttatus mgf009982m I 0.553
mgf010765m Mimulus guttatus mgf010765m I 0.524
mgf011463m Mimulus guttatus mgf011463m I 0.553
mgf015806m Mimulus guttatus mgf015806m I 0.553
mgf015972m Mimulus guttatus mgf015972m I 0.524
mgf019496m Mimulus guttatus mgf019496m I 0.553
mgf023167m Mimulus guttatus mgf023167m I 0.512
Aquca_006_00412 Aquilegia coerulea Aquca_006_00412 I 0.501
Aquca_009_00652 Aquilegia coerulea Aquca_009_00652 I 0.553
Aquca_020_00105 Aquilegia coerulea Aquca_020_00105 I 0.524
AZW_EuGene.0200010417 Micromonas sp RCC299 AZW_EuGene.0200010417 I 0.531
Bostr.10273s0455 Boechera stricta Bostr.10273s0455 I 0.547
Bostr.12659s0203 Boechera stricta Bostr.12659s0203 I 0.540
mgf007067m Mimulus guttatus mgf007067m I 0.547
mgf003166m Mimulus guttatus mgf003166m I 0.553
cassava40986.m1 Manihot esculenta cassava40986.m1 I 0.553
cassava41595.m1 Manihot esculenta cassava41595.m1 I 0.574
cassava43469.valid.m1 Manihot esculenta cassava43469.valid.m1 I 0.553
Cucsa.086660 Cucumis sativus Cucsa.086660 I 0.553
Cucsa.132170 Cucumis sativus Cucsa.132170 I 0.524
Cucsa.284430 Cucumis sativus Cucsa.284430 I 0.547
Cucsa.286190 Cucumis sativus Cucsa.286190 I 0.521
Cucsa.295080 Cucumis sativus Cucsa.295080 I 0.524
Cucsa.302100 Cucumis sativus Cucsa.302100 I 0.553
Cucsa.320600 Cucumis sativus Cucsa.320600 I 0.553
Cucsa.394330 Cucumis sativus Cucsa.394330 I 0.545
EuGene.0000040541 Micromonas pusilla EuGene.0000040541 I 0.525
mgf001016m Mimulus guttatus mgf001016m I 0.517
Bostr.14547s0027 Boechera stricta Bostr.14547s0027 I 0.553
Ca_21472 Cicer arietinum Ca_21472 I 0.563
Sb01g042850 Sorghum bicolor Sb01g042850 I 0.514
Solyc06g073920.2 Solanum lycopersicum Solyc06g073920.2 I 0.553
Solyc07g008180.2 Solanum lycopersicum Solyc07g008180.2 I 0.524
Solyc08g079100.2 Solanum lycopersicum Solyc08g079100.2 I 0.553
Solyc11g071810.1 Solanum lycopersicum Solyc11g071810.1 I 0.553
Solyc12g009580.1 Solanum lycopersicum Solyc12g009580.1 I 0.524
TCM_005549 Theobroma cacao TCM_005549 I 0.553
TCM_011484 Theobroma cacao TCM_011484 I 0.547
TCM_016030 Theobroma cacao TCM_016030 I 0.553
TCM_031868 Theobroma cacao TCM_031868 I 0.524
TCM_038105 Theobroma cacao TCM_038105 I 0.524
TCM_041175 Theobroma cacao TCM_041175 I 0.553
Traes_1DL_C5AF9D06A Triticum aestivum Traes_1DL_C5AF9D06A I 0.553
Traes_2AL_71DE02042 Triticum aestivum Traes_2AL_71DE02042 I 0.553
Solyc05g012050.2 Solanum lycopersicum Solyc05g012050.2 I 0.551
Solyc05g005240.1 Solanum lycopersicum Solyc05g005240.1 I 0.508
Sb02g003390 Sorghum bicolor Sb02g003390 I 0.553
Sb04g033590 Sorghum bicolor Sb04g033590 I 0.553
Sb06g023770 Sorghum bicolor Sb06g023770 I 0.553
Sb08g022030 Sorghum bicolor Sb08g022030 I 0.553
AFO Arabidopsis lyrata scaffold_403460.1 I 0.553
Si010859m.g Setaria italica Si010859m.g I 0.553
Si018146m.g Setaria italica Si018146m.g I 0.553
Si023308m.g Setaria italica Si023308m.g I 0.553
Si030811m.g Setaria italica Si030811m.g I 0.553
Si036788m.g Setaria italica Si036788m.g I 0.553
Si037608m.g Setaria italica Si037608m.g I 0.514
Si037789m.g Setaria italica Si037789m.g I 0.553
Solyc01g091010.2 Solanum lycopersicum Solyc01g091010.2 I 0.553
Traes_2BL_8BEA9CE1B Triticum aestivum Traes_2BL_8BEA9CE1B I 0.553
Traes_3AL_730255B9F Triticum aestivum Traes_3AL_730255B9F I 0.500
Traes_4AS_BE972A2661 Triticum aestivum Traes_4AS_BE972A2661 I 0.514
TRIUR3_31693 Triticum urartu TRIUR3_31693 I 0.514
UHOR_08529 Ustilago hordei UHOR_08529 I 0.417
UM06001 Ustilago maydis UM06001 I 0.417
CRC Vitis vinifera VIT_01s0011g00140 I 0.547
INO Vitis vinifera VIT_01s0127g00330 I 0.574
VIT_02s0154g00070 Vitis vinifera VIT_02s0154g00070 I 0.553
YAB2 Vitis vinifera VIT_06s0009g00880 I 0.553
VIT_08s0032g01110 Vitis vinifera VIT_08s0032g01110 I 0.563
YAB5 Vitis vinifera VIT_11s0016g05590 I 0.524
VIT_15s0048g00550 Vitis vinifera VIT_15s0048g00550 I 0.553
Ca_06681 Cicer arietinum Ca_06681 I 0.524
Ca_07101 Cicer arietinum Ca_07101 I 0.553
Ca_12379 Cicer arietinum Ca_12379 I 0.547
TRIUR3_29073 Triticum urartu TRIUR3_29073 I 0.553
TRIUR3_27479 Triticum urartu TRIUR3_27479 I 0.553
Traes_4AS_BE972A266 Triticum aestivum Traes_4AS_BE972A266 I 0.514
Traes_4BL_34FE2C7F2 Triticum aestivum Traes_4BL_34FE2C7F2 I 0.514
Traes_5AL_EB97D69D7 Triticum aestivum Traes_5AL_EB97D69D7 I 0.553
Traes_5AS_31C2540C0 Triticum aestivum Traes_5AS_31C2540C0 I 0.553
Traes_5BL_4DEC298F9 Triticum aestivum Traes_5BL_4DEC298F9 I 0.553
Traes_5BS_A782F7510 Triticum aestivum Traes_5BS_A782F7510 I 0.553
Traes_5DL_0E369E1FC Triticum aestivum Traes_5DL_0E369E1FC I 0.553
Traes_5DS_268147383 Triticum aestivum Traes_5DS_268147383 I 0.553
Traes_6AL_2983D4EB6 Triticum aestivum Traes_6AL_2983D4EB6 I 0.553
Traes_6BL_3F8DB6043 Triticum aestivum Traes_6BL_3F8DB6043 I 0.553
Traes_6DL_59DB06B9F Triticum aestivum Traes_6DL_59DB06B9F I 0.553
TRIUR3_18590 Triticum urartu TRIUR3_18590 I 0.553
TRIUR3_27402 Triticum urartu TRIUR3_27402 I 0.553
Ca_18533 Cicer arietinum Ca_18533 I 0.547
Bostr.22545s0001 Boechera stricta Bostr.22545s0001 I 0.524
MDP0000171878 Malus domestica MDP0000171878 I 0.547
Pavir.Aa01223 Panicum virgatum Pavir.Aa01223 I 0.553
Pavir.Ab02534 Panicum virgatum Pavir.Ab02534 I 0.553
Pavir.Ba00601 Panicum virgatum Pavir.Ba00601 I 0.495
Pavir.Ba03779 Panicum virgatum Pavir.Ba03779 I 0.553
Pavir.Bb03145 Panicum virgatum Pavir.Bb03145 I 0.495
Pavir.Ca02862 Panicum virgatum Pavir.Ca02862 I 0.553
Pavir.Cb00070 Panicum virgatum Pavir.Cb00070 I 0.553
Pavir.Ga00891 Panicum virgatum Pavir.Ga00891 I 0.553
Pavir.Gb00743 Panicum virgatum Pavir.Gb00743 I 0.553
Pavir.Ia01130 Panicum virgatum Pavir.Ia01130 I 0.553
Pavir.Ia04690 Panicum virgatum Pavir.Ia04690 I 0.514
Pavir.Ib00755 Panicum virgatum Pavir.Ib00755 I 0.514
Pavir.Ib03707 Panicum virgatum Pavir.Ib03707 I 0.553
orange1.1g046045m.g Citrus sinensis orange1.1g046045m.g I 0.500
orange1.1g037247m.g Citrus sinensis orange1.1g037247m.g I 0.574
MDP0000192940 Malus domestica MDP0000192940 I 0.553
MDP0000252640 Malus domestica MDP0000252640 I 0.553
MDP0000255415 Malus domestica MDP0000255415 I 0.524
MDP0000263713 Malus domestica MDP0000263713 I 0.574
MDP0000291729 Malus domestica MDP0000291729 I 0.547
MDP0000298333 Malus domestica MDP0000298333 I 0.553
MDP0000331808 Malus domestica MDP0000331808 I 0.553
MDP0000366291 Malus domestica MDP0000366291 I 0.553
MDP0000500810 Malus domestica MDP0000500810 I 0.553
orange1.1g027215m.g Citrus sinensis orange1.1g027215m.g I 0.553
orange1.1g028144m.g Citrus sinensis orange1.1g028144m.g I 0.553
orange1.1g028980m.g Citrus sinensis orange1.1g028980m.g I 0.524
orange1.1g029862m.g Citrus sinensis orange1.1g029862m.g I 0.553
Pavir.Ib04136 Panicum virgatum Pavir.Ib04136 I 0.553
SapurV1A.0033s0530 Salix purpurea SapurV1A.0033s0530 I 0.553
SapurV1A.0034s0500 Salix purpurea SapurV1A.0034s0500 I 0.524
Thhalv10008858m.g Eutrema salsugineum Thhalv10008858m.g I 0.553
Thhalv10017320m.g Eutrema salsugineum Thhalv10017320m.g I 0.524
Thhalv10019126m.g Eutrema salsugineum Thhalv10019126m.g I 0.547
Thhalv10028925m.g Eutrema salsugineum Thhalv10028925m.g I 0.553
PK06964.1 Cannabis sativa PK06964.1 I 0.553
PK09461.1 Cannabis sativa PK09461.1 I 0.524
PK13838.1 Cannabis sativa PK13838.1 I 0.547
chr2.CM0008.270.nc Lotus japonicus chr2.CM0008.270.nc I 0.568
chr2.CM0237.250.nd Lotus japonicus chr2.CM0237.250.nd I 0.500
e_gw1.1.2342.1 Heterobasidion annosum e_gw1.1.2342.1 I 0.474
LjSGA_107961.1 Lotus japonicus LjSGA_107961.1 I 0.553
PDK_20s1325902g001 Phoenix dactylifera PDK_20s1325902g001 I 0.514
PDK_20s1781371g001 Phoenix dactylifera PDK_20s1781371g001 I 0.575
Thhalv10008669m.g Eutrema salsugineum Thhalv10008669m.g I 0.540
Thhalv10001617m.g Eutrema salsugineum Thhalv10001617m.g I 0.553
SapurV1A.0069s0070 Salix purpurea SapurV1A.0069s0070 I 0.538
SapurV1A.0072s0330 Salix purpurea SapurV1A.0072s0330 I 0.541
SapurV1A.0176s0460 Salix purpurea SapurV1A.0176s0460 I 0.514
SapurV1A.0217s0100 Salix purpurea SapurV1A.0217s0100 I 0.553
SapurV1A.0248s0170 Salix purpurea SapurV1A.0248s0170 I 0.558
SapurV1A.0258s0090 Salix purpurea SapurV1A.0258s0090 I 0.553
SapurV1A.0269s0230 Salix purpurea SapurV1A.0269s0230 I 0.545
SapurV1A.0288s0210 Salix purpurea SapurV1A.0288s0210 I 0.588
SapurV1A.0634s0130 Salix purpurea SapurV1A.0634s0130 I 0.553
SapurV1A.1100s0080 Salix purpurea SapurV1A.1100s0080 I 0.524
SapurV1A.1275s0050 Salix purpurea SapurV1A.1275s0050 I 0.553
SapurV1A.2672s0010 Salix purpurea SapurV1A.2672s0010 I 0.553
SapurV1A.3336s0010 Salix purpurea SapurV1A.3336s0010 I 0.588
XP_002163918.1 Hydra magnipapillata XP_002163918.1 I 0.435
MDP0000126221 Malus domestica MDP0000126221 I 0.574
Bostr.25219s0098 Boechera stricta Bostr.25219s0098 I 0.553
Ciclev10022170m.g Citrus clementina Ciclev10022170m.g I 0.553
Ciclev10029354m.g Citrus clementina Ciclev10029354m.g I 0.553
Ciclev10033714m.g Citrus clementina Ciclev10033714m.g I 0.521
Ciclev10033770m.g Citrus clementina Ciclev10033770m.g I 0.514
est_cluster_kg.Chr_05__92__3202834:1 Micromonas sp RCC299 est_cluster_kg.Chr_05__92__3202834:1 I 0.537
Eucgr.B03140 Eucalyptus grandis Eucgr.B03140 I 0.547
Eucgr.B03310 Eucalyptus grandis Eucgr.B03310 I 0.544
Eucgr.C01515 Eucalyptus grandis Eucgr.C01515 I 0.524
Eucgr.D02474 Eucalyptus grandis Eucgr.D02474 I 0.553
Eucgr.E01474 Eucalyptus grandis Eucgr.E01474 I 0.553
Eucgr.J00587 Eucalyptus grandis Eucgr.J00587 I 0.553
EuGene.0300010215 Micromonas sp RCC299 EuGene.0300010215 I 0.537
evm.TU.contig_30608 Carica papaya evm.TU.contig_30608 I 0.547
Ciclev10021834m.g Citrus clementina Ciclev10021834m.g I 0.553
Ciclev10009560m.g Citrus clementina Ciclev10009560m.g I 0.524
Bostr.25993s0255 Boechera stricta Bostr.25993s0255 I 0.553
Cagra.0239s0072 Capsella grandiflora Cagra.0239s0072 I 0.553
Cagra.0537s0004 Capsella grandiflora Cagra.0537s0004 I 0.547
Cagra.0605s0067 Capsella grandiflora Cagra.0605s0067 I 0.540
Cagra.11302s0003 Capsella grandiflora Cagra.11302s0003 I 0.524
Cagra.1261s0010 Capsella grandiflora Cagra.1261s0010 I 0.553
Cagra.4395s0036 Capsella grandiflora Cagra.4395s0036 I 0.553
Carubv10001833m.g Capsella rubella Carubv10001833m.g I 0.553
Carubv10010384m.g Capsella rubella Carubv10010384m.g I 0.553
Carubv10012024m.g Capsella rubella Carubv10012024m.g I 0.540
Carubv10021641m.g Capsella rubella Carubv10021641m.g I 0.547
Carubv10024011m.g Capsella rubella Carubv10024011m.g I 0.553
Carubv10024208m.g Capsella rubella Carubv10024208m.g I 0.524
evm.TU.supercontig_103.34 Carica papaya evm.TU.supercontig_103.34 I 0.553
evm.TU.supercontig_104.5 Carica papaya evm.TU.supercontig_104.5 I 0.553
evm.TU.supercontig_145.3 Carica papaya evm.TU.supercontig_145.3 I 0.553
Gorai.009G016700 Gossypium raimondii Gorai.009G016700 I 0.524
Gorai.009G367100 Gossypium raimondii Gorai.009G367100 I 0.524
Gorai.010G062900 Gossypium raimondii Gorai.010G062900 I 0.553
Lus10010361.g Linum usitatissimum Lus10010361.g I 0.553
Lus10013028.g Linum usitatissimum Lus10013028.g I 0.545
Lus10019407.g Linum usitatissimum Lus10019407.g I 0.524
Lus10024603.g Linum usitatissimum Lus10024603.g I 0.558
Lus10029135.g Linum usitatissimum Lus10029135.g I 0.545
Lus10030596.g Linum usitatissimum Lus10030596.g I 0.443
Lus10030892.g Linum usitatissimum Lus10030892.g I 0.521
Lus10032240.g Linum usitatissimum Lus10032240.g I 0.558
Lus10036496.g Linum usitatissimum Lus10036496.g I 0.553
Lus10036811.g Linum usitatissimum Lus10036811.g I 0.547
Gorai.008G236500 Gossypium raimondii Gorai.008G236500 I 0.553
Gorai.007G089700 Gossypium raimondii Gorai.007G089700 I 0.454
evm.TU.supercontig_29.121 Carica papaya evm.TU.supercontig_29.121 I 0.553
evm.TU.supercontig_46.14 Carica papaya evm.TU.supercontig_46.14 I 0.524
evm.TU.supercontig_69.72 Carica papaya evm.TU.supercontig_69.72 I 0.546
gene03938-v1.0-hybrid Fragaria vesca gene03938-v1.0-hybrid I 0.553
gene04566-v1.0-hybrid Fragaria vesca gene04566-v1.0-hybrid I 0.553
gene31056-v1.0-hybrid Fragaria vesca gene31056-v1.0-hybrid I 0.524
gene32251-v1.0-hybrid Fragaria vesca gene32251-v1.0-hybrid I 0.553
Gorai.001G042700 Gossypium raimondii Gorai.001G042700 I 0.524
Gorai.001G127000 Gossypium raimondii Gorai.001G127000 I 0.553
Gorai.001G174800 Gossypium raimondii Gorai.001G174800 I 0.553
Gorai.002G054200 Gossypium raimondii Gorai.002G054200 I 0.524
Gorai.005G146700 Gossypium raimondii Gorai.005G146700 I 0.547
Gorai.006G117800 Gossypium raimondii Gorai.006G117800 I 0.553
MDP0000124879 Malus domestica MDP0000124879 I 0.547
YAB3 Arabidopsis lyrata fgenesh2_kg.6__3684__AT4G00180.1 I 0.553
GLYMA12G31670 Glycine max GLYMA12G31670 I 0.553
GLYMA13G22620 Glycine max GLYMA13G22620 I 0.524
GLYMA13G38750 Glycine max GLYMA13G38750 I 0.553
GLYMA17G12200 Glycine max GLYMA17G12200 I 0.524
GLYMA17G14710 Glycine max GLYMA17G14710 I 0.553
GLYMA18G19720 Glycine max GLYMA18G19720 I 0.568
GRMZM2G005353 Zea mays GRMZM2G005353 I 0.553
GRMZM2G046829 Zea mays GRMZM2G046829 I 0.533
GRMZM2G054795 Zea mays GRMZM2G054795 I 0.553
GRMZM2G074124 Zea mays GRMZM2G074124 I 0.553
GRMZM2G074543 Zea mays GRMZM2G074543 I 0.553
GRMZM2G085873 Zea mays GRMZM2G085873 I 0.553
GRMZM2G088309 Zea mays GRMZM2G088309 I 0.514
GLYMA12G10210 Glycine max GLYMA12G10210 I 0.553
GLYMA08G39290 Glycine max GLYMA08G39290 I 0.568
GLOINDRAFT_334763 Rhizophagus irregularis GLOINDRAFT_334763 I 0.592
GLOINDRAFT_337448 Rhizophagus irregularis GLOINDRAFT_337448 I 0.544
GLOINDRAFT_338425 Rhizophagus irregularis GLOINDRAFT_338425 I 0.476
GLOINDRAFT_342259 Rhizophagus irregularis GLOINDRAFT_342259 I 0.589
GLYMA01G03580 Glycine max GLYMA01G03580 I 0.482
GLYMA01G08030 Glycine max GLYMA01G08030 I 0.547
GLYMA01G33370 Glycine max GLYMA01G33370 I 0.553
GLYMA02G13350 Glycine max GLYMA02G13350 I 0.547
GLYMA03G03500 Glycine max GLYMA03G03500 I 0.553
GLYMA04G10125 Glycine max GLYMA04G10125 I 0.538
GLYMA05G04260 Glycine max GLYMA05G04260 I 0.553
GLYMA06G10110 Glycine max GLYMA06G10110 I 0.538
GLYMA06G46560 Glycine max GLYMA06G46560 I 0.553
GRMZM2G102218 Zea mays GRMZM2G102218 I 0.514
GRMZM2G106204 Zea mays GRMZM2G106204 I 0.553
GRMZM2G116646 Zea mays GRMZM2G116646 I 0.588
GSMUA_Achr4G31310_001 Musa acuminata GSMUA_Achr4G31310_001 I 0.534
GSMUA_Achr5G08930_001 Musa acuminata GSMUA_Achr5G08930_001 I 0.514
GSMUA_Achr5G23610_001 Musa acuminata GSMUA_Achr5G23610_001 I 0.508
GSMUA_Achr6G24550_001 Musa acuminata GSMUA_Achr6G24550_001 I 0.514
GSMUA_Achr6G31080_001 Musa acuminata GSMUA_Achr6G31080_001 I 0.563
GSMUA_Achr7G01330_001 Musa acuminata GSMUA_Achr7G01330_001 I 0.553
GSMUA_Achr7G07130_001 Musa acuminata GSMUA_Achr7G07130_001 I 0.553
GSMUA_Achr7G07830_001 Musa acuminata GSMUA_Achr7G07830_001 I 0.563
GSMUA_Achr8G04340_001 Musa acuminata GSMUA_Achr8G04340_001 I 0.491
GSMUA_Achr8G04750_001 Musa acuminata GSMUA_Achr8G04750_001 I 0.563
GSMUA_Achr8G11580_001 Musa acuminata GSMUA_Achr8G11580_001 I 0.553
GSMUA_Achr8G26600_001 Musa acuminata GSMUA_Achr8G26600_001 I 0.570
GSMUA_AchrUn_randomG19410_001 Musa acuminata GSMUA_AchrUn_randomG19410_001 I 0.553
GSMUA_Achr4G22750_001 Musa acuminata GSMUA_Achr4G22750_001 I 0.524
GSMUA_Achr4G01430_001 Musa acuminata GSMUA_Achr4G01430_001 I 0.514
GRMZM2G141955 Zea mays GRMZM2G141955 I 0.553
GRMZM2G167824 Zea mays GRMZM2G167824 I 0.553
GRMZM2G529859 Zea mays GRMZM2G529859 I 0.553
GSMUA_Achr11G03800_001 Musa acuminata GSMUA_Achr11G03800_001 I 0.553
GSMUA_Achr11G17520_001 Musa acuminata GSMUA_Achr11G17520_001 I 0.553
GSMUA_Achr1G04480_001 Musa acuminata GSMUA_Achr1G04480_001 I 0.508
GSMUA_Achr1G24490_001 Musa acuminata GSMUA_Achr1G24490_001 I 0.508
GSMUA_Achr1G27150_001 Musa acuminata GSMUA_Achr1G27150_001 I 0.508
GSMUA_Achr2G12850_001 Musa acuminata GSMUA_Achr2G12850_001 I 0.560
GSMUA_Achr3G15060_001 Musa acuminata GSMUA_Achr3G15060_001 I 0.570
GSMUA_Achr3G25290_001 Musa acuminata GSMUA_Achr3G25290_001 I 0.491
GSMUA_Achr3G25660_001 Musa acuminata GSMUA_Achr3G25660_001 I 0.491
GSMUA_Achr3G30800_001 Musa acuminata GSMUA_Achr3G30800_001 I 0.547
GUITHDRAFT_146350 Guillardia theta GUITHDRAFT_146350 I 0.549
AMAG_00993 Allomyces macrogynus AMAG_00993 I 0.453
BGIOSGA037817 Oryza indica BGIOSGA037817 I 0.553
Bo3g037630 Brassica oleracea Bo3g037630 I 0.553
Bo3g041840 Brassica oleracea Bo3g041840 I 0.524
Bo4g195410 Brassica oleracea Bo4g195410 I 0.553
Bo5g009010 Brassica oleracea Bo5g009010 I 0.553
Bo5g039580 Brassica oleracea Bo5g039580 I 0.540
Bo6g073320 Brassica oleracea Bo6g073320 I 0.553
Bo6g108630 Brassica oleracea Bo6g108630 I 0.547
Bo7g056180 Brassica oleracea Bo7g056180 I 0.540
Bo8g055830 Brassica oleracea Bo8g055830 I 0.553
Bo8g112450 Brassica oleracea Bo8g112450 I 0.553
Bo9g001130 Brassica oleracea Bo9g001130 I 0.553
BOTBODRAFT_39377 Botryobasidium botryosum BOTBODRAFT_39377 I 0.433
BGIOSGA025976 Oryza indica BGIOSGA025976 I 0.501
BGIOSGA014650 Oryza indica BGIOSGA014650 I 0.553
AMAG_02504 Allomyces macrogynus AMAG_02504 I 0.521
SPPG_01639 Spizellomyces punctatus SPPG_01639 I 0.557
SPPG_09438 Spizellomyces punctatus SPPG_09438 I 0.570
AMTR_s00004p00165390 Amborella trichopoda AMTR_s00004p00165390 I 0.553
AMTR_s00047p00199030 Amborella trichopoda AMTR_s00047p00199030 I 0.547
AMTR_s00078p00029420 Amborella trichopoda AMTR_s00078p00029420 I 0.553
AMTR_s00085p00032940 Amborella trichopoda AMTR_s00085p00032940 I 0.553
AMTR_s00096p00054100 Amborella trichopoda AMTR_s00096p00054100 I 0.538
YAB2 Arabidopsis thaliana AT1G08465 I 0.553
YAB3 Arabidopsis thaliana AT4G00180 I 0.553
BATDEDRAFT_7789 Batrachochytrium dendrobatidis BATDEDRAFT_7789 I 0.580
BGIOSGA012115 Oryza indica BGIOSGA012115 I 0.514
BGIOSGA013223 Oryza indica BGIOSGA013223 I 0.553
Bra000378 Brassica rapa Bra000378 I 0.553
Bra000538 Brassica rapa Bra000538 I 0.524
Bra003309 Brassica rapa Bra003309 I 0.553
CMT447C Cyanidioschyzon merolae CMT447C I 0.453
CND03770 Cryptococcus neoformans CND03770 I 0.488
DACRYDRAFT_54873 Dacryopinax sp DACRYDRAFT_54873 I 0.484
E5Q_04235 Mixia osmundae E5Q_04235 I 0.426
E5Q_04236 Mixia osmundae E5Q_04236 I 0.426
EMIHUDRAFT_114782 Emiliania huxleyi EMIHUDRAFT_114782 I 0.482
EMIHUDRAFT_98817 Emiliania huxleyi EMIHUDRAFT_98817 I 0.482
F775_25525 Aegilops tauschii F775_25525 I 0.553
F775_27799 Aegilops tauschii F775_27799 I 0.553
F775_28710 Aegilops tauschii F775_28710 I 0.553
INO Arabidopsis lyrata fgenesh1_pg.C_scaffold_1002152 I 0.540
YAB2 Arabidopsis lyrata fgenesh2_kg.1__861__AT1G08465.1 I 0.553
CRC Arabidopsis lyrata fgenesh2_kg.2__1172__AT1G69180.1 I 0.547
BRADI5G16910 Brachypodium distachyon BRADI5G16910 I 0.553
BRADI4G01300 Brachypodium distachyon BRADI4G01300 I 0.553
Bra004364 Brassica rapa Bra004364 I 0.547
Bra012373 Brassica rapa Bra012373 I 0.540
Bra018624 Brassica rapa Bra018624 I 0.553
Bra024599 Brassica rapa Bra024599 I 0.540
Bra030728 Brassica rapa Bra030728 I 0.553
Bra031629 Brassica rapa Bra031629 I 0.553
Bra037320 Brassica rapa Bra037320 I 0.553
Bra040322 Brassica rapa Bra040322 I 0.553
BRADI1G13570 Brachypodium distachyon BRADI1G13570 I 0.553
BRADI1G57070 Brachypodium distachyon BRADI1G57070 I 0.553
BRADI1G69900 Brachypodium distachyon BRADI1G69900 I 0.514
BRADI3G30410 Brachypodium distachyon BRADI3G30410 I 0.553
BRADI3G50050 Brachypodium distachyon BRADI3G50050 I 0.553
YAB5 Arabidopsis lyrata fgenesh2_kg.4__584__AT2G26580.2 I 0.524
GUITHDRAFT_163519 Guillardia theta GUITHDRAFT_163519 I 0.474
OPUNC02G23520 Oryza punctata OPUNC02G23520 I 0.553
ORUFI10G16240 Oryza rufipogon ORUFI10G16240 I 0.553
ORUFI12G21410 Oryza rufipogon ORUFI12G21410 I 0.553
YAB4 Oryza sativa OS02G0643200 I 0.553
OS03G0215200 Oryza sativa OS03G0215200 I 0.514
YAB2 Oryza sativa OS03G0650000 I 0.553
YAB5 Oryza sativa OS04G0536300 I 0.553
YAB1 Oryza sativa OS07G0160100 I 0.553
YAB3 Oryza sativa OS10G0508300 I 0.553
YAB6 Oryza sativa OS12G0621100 I 0.553
PaG_05633 Pseudozyma aphidis PaG_05633 I 0.417
PAN0_018d5604 Pseudozyma antarctica PAN0_018d5604 I 0.417
PFL1_06190 Pseudozyma flocculosa PFL1_06190 I 0.449
PGSC0003DMG400002883 Solanum tuberosum PGSC0003DMG400002883 I 0.524
ORUFI07G03450 Oryza rufipogon ORUFI07G03450 I 0.553
ORUFI04G21570 Oryza rufipogon ORUFI04G21570 I 0.553
OPUNC03G08080 Oryza punctata OPUNC03G08080 I 0.514
OPUNC03G25290 Oryza punctata OPUNC03G25290 I 0.553
OPUNC07G03670 Oryza punctata OPUNC07G03670 I 0.553
OPUNC10G13730 Oryza punctata OPUNC10G13730 I 0.553
OPUNC12G17340 Oryza punctata OPUNC12G17340 I 0.553
ORGLA02G0220100 Oryza glaberrima ORGLA02G0220100 I 0.553
ORGLA03G0081000 Oryza glaberrima ORGLA03G0081000 I 0.514
ORGLA04G0171000 Oryza glaberrima ORGLA04G0171000 I 0.553
ORGLA07G0250200 Oryza glaberrima ORGLA07G0250200 I 0.501
ORGLA12G0165000 Oryza glaberrima ORGLA12G0165000 I 0.553
ORUFI02G27080 Oryza rufipogon ORUFI02G27080 I 0.553
ORUFI03G08400 Oryza rufipogon ORUFI03G08400 I 0.514
ORUFI03G28820 Oryza rufipogon ORUFI03G28820 I 0.553
PGSC0003DMG400002988 Solanum tuberosum PGSC0003DMG400002988 I 0.553
PGSC0003DMG400004741 Solanum tuberosum PGSC0003DMG400004741 I 0.553
POPTR_0010s05220 Populus trichocarpa POPTR_0010s05220 I 0.545
POPTR_0010s16410 Populus trichocarpa POPTR_0010s16410 I 0.541
POPTR_0014s06210 Populus trichocarpa POPTR_0014s06210 I 0.553
POPTR_0016s06760 Populus trichocarpa POPTR_0016s06760 I 0.553
POPTR_0018s12990 Populus trichocarpa POPTR_0018s12990 I 0.524
PRUPE_ppa010905mg Prunus persica PRUPE_ppa010905mg I 0.553
PRUPE_ppa011209mg Prunus persica PRUPE_ppa011209mg I 0.553
PRUPE_ppa011880m2g Prunus persica PRUPE_ppa011880m2g I 0.553
PRUPE_ppa012028mg Prunus persica PRUPE_ppa012028mg I 0.524
PRUPE_ppa014900mg Prunus persica PRUPE_ppa014900mg I 0.547
PRUPE_ppa023883mg Prunus persica PRUPE_ppa023883mg I 0.545
PSEUBRA_SCAF20g03069 Pseudozyma brasiliensis PSEUBRA_SCAF20g03069 I 0.417
Sb01g013270 Sorghum bicolor Sb01g013270 I 0.553
POPTR_0008s09740 Populus trichocarpa POPTR_0008s09740 I 0.514
POPTR_0006s06700 Populus trichocarpa POPTR_0006s06700 I 0.524
PGSC0003DMG400005936 Solanum tuberosum PGSC0003DMG400005936 I 0.553
POPTR_0008s19330 Populus trichocarpa POPTR_0008s19330 I 0.568
PGSC0003DMG400025969 Solanum tuberosum PGSC0003DMG400025969 I 0.553
PGSC0003DMG400028360 Solanum tuberosum PGSC0003DMG400028360 I 0.551
PGSC0003DMG400030904 Solanum tuberosum PGSC0003DMG400030904 I 0.524
PILCRDRAFT_822980 Piloderma croceum PILCRDRAFT_822980 I 0.477
PLEOSDRAFT_155914 Pleurotus ostreatus PLEOSDRAFT_155914 I 0.422
PLICRDRAFT_179042 Plicaturopsis crispa PLICRDRAFT_179042 I 0.488
PNEG_03347 Pneumocystis murina PNEG_03347 I 0.421
POPTR_0001s00240 Populus trichocarpa POPTR_0001s00240 I 0.553
YAB2 Populus trichocarpa POPTR_0001s22180 I 0.553
POPTR_0002s14600 Populus trichocarpa POPTR_0002s14600 I 0.553
POPTR_0003s11230 Populus trichocarpa POPTR_0003s11230 I 0.553
Sb01g017560 Sorghum bicolor Sb01g017560 I 0.553
ONIVA04G21490 Oryza nivara ONIVA04G21490 I 0.553
HETIRDRAFT_308278 Heterobasidion irregulare HETIRDRAFT_308278 I 0.474
MTR_4g025900 Medicago truncatula MTR_4g025900 I 0.553
MTR_4g050300 Medicago truncatula MTR_4g050300 I 0.553
MTR_4g101660 Medicago truncatula MTR_4g101660 I 0.553
MTR_4g114730 Medicago truncatula MTR_4g114730 I 0.524
MTR_5g034030 Medicago truncatula MTR_5g034030 I 0.563
OB02G33040 Oryza brachyantha OB02G33040 I 0.553
OB03G18700 Oryza brachyantha OB03G18700 I 0.514
OB03G35470 Oryza brachyantha OB03G35470 I 0.553
OB04G27010 Oryza brachyantha OB04G27010 I 0.553
OB07G12810 Oryza brachyantha OB07G12810 I 0.553
OB07G25220 Oryza brachyantha OB07G25220 I 0.501
OB12G26050 Oryza brachyantha OB12G26050 I 0.553
MTR_2g087740 Medicago truncatula MTR_2g087740 I 0.553
Moror_16065 Moniliophthora roreri Moror_16065 I 0.416
MLOC_70676 Hordeum vulgare MLOC_70676 I 0.553
K437DRAFT_256012 Tilletiaria anomala K437DRAFT_256012 I 0.467
LPERR02G20990 Leersia perrieri LPERR02G20990 I 0.553
LPERR03G07620 Leersia perrieri LPERR03G07620 I 0.514
LPERR03G22960 Leersia perrieri LPERR03G22960 I 0.553
LPERR04G16190 Leersia perrieri LPERR04G16190 I 0.553
LPERR07G03250 Leersia perrieri LPERR07G03250 I 0.553
LPERR07G16630 Leersia perrieri LPERR07G16630 I 0.501
LPERR10G11580 Leersia perrieri LPERR10G11580 I 0.553
M407DRAFT_126438 Tulasnella calospora M407DRAFT_126438 I 0.513
MLOC_60897 Hordeum vulgare MLOC_60897 I 0.553
MLOC_66260 Hordeum vulgare MLOC_66260 I 0.553
MLOC_70653 Hordeum vulgare MLOC_70653 I 0.553
OBART02G25670 Oryza barthii OBART02G25670 I 0.553
OBART03G08320 Oryza barthii OBART03G08320 I 0.514
OLONG_018621 Oryza longistaminata OLONG_018621 I 0.553
OMERI02G25190 Oryza meridionalis OMERI02G25190 I 0.553
OMERI03G08070 Oryza meridionalis OMERI03G08070 I 0.514
OMERI04G17000 Oryza meridionalis OMERI04G17000 I 0.553
OMERI07G02330 Oryza meridionalis OMERI07G02330 I 0.553
OMERI07G16070 Oryza meridionalis OMERI07G16070 I 0.501
OMERI10G11950 Oryza meridionalis OMERI10G11950 I 0.553
OMERI12G13460 Oryza meridionalis OMERI12G13460 I 0.553
ONIVA02G03100 Oryza nivara ONIVA02G03100 I 0.553
ONIVA02G28110 Oryza nivara ONIVA02G28110 I 0.553
ONIVA03G09180 Oryza nivara ONIVA03G09180 I 0.514
ONIVA03G28660 Oryza nivara ONIVA03G28660 I 0.553
ONIVA04G18220 Oryza nivara ONIVA04G18220 I 0.553
OLONG_018568 Oryza longistaminata OLONG_018568 I 0.553
OGLUM03G28370 Oryza glumaepatula OGLUM03G28370 I 0.553
OBART12G19190 Oryza barthii OBART12G19190 I 0.553
OGLUM02G26190 Oryza glumaepatula OGLUM02G26190 I 0.553
OGLUM03G08460 Oryza glumaepatula OGLUM03G08460 I 0.514
OBART04G20010 Oryza barthii OBART04G20010 I 0.553
OGLUM04G19890 Oryza glumaepatula OGLUM04G19890 I 0.553
OGLUM10G15140 Oryza glumaepatula OGLUM10G15140 I 0.553
OGLUM12G20870 Oryza glumaepatula OGLUM12G20870 I 0.553
OLONG_001420 Oryza longistaminata OLONG_001420 I 0.501
OLONG_009200 Oryza longistaminata OLONG_009200 I 0.514
OBART03G27740 Oryza barthii OBART03G27740 I 0.553
OBART10G15260 Oryza barthii OBART10G15260 I 0.553
LACBIDRAFT_301226 Laccaria bicolor LACBIDRAFT_301226 N 0.433
K443DRAFT_87716 Laccaria amethystina K443DRAFT_87716 N 0.438
OSTLU_15490 Ostreococcus lucimarinus OSTLU_15490 N 0.417
CC1G_06617 Coprinopsis cinerea CC1G_06617 N 0.479
M378DRAFT_228709 Amanita muscaria M378DRAFT_228709 N 0.428
BOTBODRAFT_110075 Botryobasidium botryosum BOTBODRAFT_110075 N 0.482
Bm12451 Brugia malayi Bm12451 N 0.423
EuGene.0000030607 Micromonas pusilla EuGene.0000030607 N 0.523
TRE_0001918901 Trichobilharzia regenti TRE_0001918901 N 0.425