NEMVEDRAFT_v1g201358 (Nematostella vectensis)
Sox

TF Information

Pfam ID Interpro ID Gene ID CIS-BP ID Sequence source Animal TF db
PF00505 (HMG_box) IPR000910 NEMVEDRAFT_v1g201358 T331475_2.00 Ensembl (2018-Dec-8) Link out

Directly determined binding motifs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
No direct experiments

Motifs from related TFs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
YAB5
M02486_2.00
Arabidopsis thaliana
NNNNHRN

NYDNNNN
PBM
Weirauch et al.(2014)
pTH7575
0.416 0.261
YAB5
M00889_2.00
Arabidopsis thaliana
NATRATTADNNN

NNNHTAATYATN
PBM
Franco-Zorrilla et al.(2014)
YAB5
0.416 0.261
YAB1
M00890_2.00
Arabidopsis thaliana
AATAATWA

TWATTATT
PBM
Franco-Zorrilla et al.(2014)
YAB1
0.416 0.261
CRC
M07266_2.00
Arabidopsis thaliana
TWATCATW

WATGATWA
Dap-seq
OMalley et al.(2016)
CRC_col_a
0.416 0.304
CRC
M07267_2.00
Arabidopsis thaliana
GGTTAGTGTTTTGGAGTCGAATATGACTTG

CAAGTCATATTCGACTCCAAAACACTAACC
Dap-seq
OMalley et al.(2016)
CRC_colamp_a
0.416 0.304
For this family, TFs with SR scores > 0.415 will likely have a similar motif

DNA Binding Domains

Protein ID Domain From To Sequence
EDO45700 Sox 153 198

Links

Other Sox family TFs
Other Nematostella vectensis TFs

479 Related TFs

Name Species Gene ID Motif Evidence SR
Score
Action
ACYPI003297 Acyrthosiphon pisum ACYPI003297 I 0.588
AAEL008417 Aedes aegypti AAEL008417 N 0.499
F775_28710 Aegilops tauschii F775_28710 I 0.416
F775_27799 Aegilops tauschii F775_27799 I 0.416
F775_25525 Aegilops tauschii F775_25525 I 0.416
ALNC14_126360 Albugo laibachii ALNC14_126360 N 0.521
AMTR_s00085p00032940 Amborella trichopoda AMTR_s00085p00032940 I 0.416
AMTR_s00078p00029420 Amborella trichopoda AMTR_s00078p00029420 I 0.416
AMTR_s00047p00199030 Amborella trichopoda AMTR_s00047p00199030 I 0.416
AMTR_s00004p00165390 Amborella trichopoda AMTR_s00004p00165390 I 0.416
ANCCAN_29654 Ancylostoma caninum ANCCAN_29654 N 0.635
ANCCEY_08672 Ancylostoma ceylanicum ANCCEY_08672 N 0.635
ACAC_0000409101 Angiostrongylus cantonensis ACAC_0000409101 N 0.635
ACOC_0001323101 Angiostrongylus costaricensis ACOC_0001323101 N 0.635
AALB007196 Anopheles albimanus AALB007196 N 0.549
AARA009694 Anopheles arabiensis AARA009694 N 0.581
AATE006267 Anopheles atroparvus AATE006267 N 0.549
ACHR002403 Anopheles christyi ACHR002403 N 0.581
ACOM033320 Anopheles coluzzii ACOM033320 N 0.581
ACUA003510 Anopheles culicifacies ACUA003510 N 0.581
ADAC009894 Anopheles darlingi ADAC009894 N 0.549
ADIR002941 Anopheles dirus ADIR002941 N 0.549
AEPI008570 Anopheles epiroticus AEPI008570 N 0.581
AFAF018499 Anopheles farauti AFAF018499 N 0.549
AFUN011346 Anopheles funestus AFUN011346 N 0.549
AGAP004110 Anopheles gambiae AGAP004110 N 0.581
AMAM021723 Anopheles maculatus AMAM021723 N 0.504
AMEC005071 Anopheles melas AMEC005071 N 0.581
AMEM002948 Anopheles merus AMEM002948 N 0.581
AMIN003838 Anopheles minimus AMIN003838 N 0.549
AQUA009805 Anopheles quadriannulatus AQUA009805 N 0.581
ASIS023527 Anopheles sinensis ASIS023527 N 0.581
ASTEI04275 Anopheles stephensi ASTEI04275 N 0.581
GB50764 Apis mellifera GB50764 I 0.683
Aquca_009_00652 Aquilegia coerulea Aquca_009_00652 I 0.416
Aquca_020_00105 Aquilegia coerulea Aquca_020_00105 I 0.416
YAB3 Arabidopsis lyrata fgenesh2_kg.6__3684__AT4G00180.1 I 0.416
YAB5 Arabidopsis lyrata fgenesh2_kg.4__584__AT2G26580.2 I 0.416
CRC Arabidopsis lyrata fgenesh2_kg.2__1172__AT1G69180.1 I 0.416
YAB2 Arabidopsis lyrata fgenesh2_kg.1__861__AT1G08465.1 I 0.416
AFO Arabidopsis lyrata scaffold_403460.1 I 0.416
YAB2 Arabidopsis thaliana AT1G08465 I 0.416
CRC Arabidopsis thaliana AT1G69180 D 0.416
YAB1 Arabidopsis thaliana AT2G45190 D 0.416
YAB5 Arabidopsis thaliana AT2G26580 D 0.416
YAB3 Arabidopsis thaliana AT4G00180 I 0.416
ALUE_0001851001 Ascaris lumbricoides ALUE_0001851001 N 0.670
ASU_10445 Ascaris suum ASU_10445 N 0.670
ACEP12759 Atta cephalotes ACEP12759 I 0.683
BATDEDRAFT_89306 Batrachochytrium dendrobatidis BATDEDRAFT_89306 N 0.451
Bostr.22545s0001 Boechera stricta Bostr.22545s0001 I 0.416
Bostr.25219s0098 Boechera stricta Bostr.25219s0098 I 0.416
Bostr.25993s0255 Boechera stricta Bostr.25993s0255 I 0.416
Bostr.10273s0455 Boechera stricta Bostr.10273s0455 I 0.416
Bostr.14547s0027 Boechera stricta Bostr.14547s0027 I 0.416
BGIBMGA013514 Bombyx mori BGIBMGA013514 N 0.629
BRADI1G13570 Brachypodium distachyon BRADI1G13570 I 0.416
BRADI4G01300 Brachypodium distachyon BRADI4G01300 I 0.416
BRADI3G50050 Brachypodium distachyon BRADI3G50050 I 0.416
BRADI1G57070 Brachypodium distachyon BRADI1G57070 I 0.427
BRADI3G30410 Brachypodium distachyon BRADI3G30410 I 0.416
BRADI5G16910 Brachypodium distachyon BRADI5G16910 I 0.416
estExt_fgenesh2_pm.C_3240002 Branchiostoma floridae estExt_fgenesh2_pm.C_3240002 N 0.624
estExt_fgenesh2_pg.C_1070085 Branchiostoma floridae estExt_fgenesh2_pg.C_1070085 N 0.624
Bo4g195410 Brassica oleracea Bo4g195410 I 0.416
Bo5g009010 Brassica oleracea Bo5g009010 I 0.416
Bo9g001130 Brassica oleracea Bo9g001130 I 0.416
Bo3g041840 Brassica oleracea Bo3g041840 I 0.416
Bo6g108630 Brassica oleracea Bo6g108630 I 0.416
Bo6g073320 Brassica oleracea Bo6g073320 I 0.416
Bo8g055830 Brassica oleracea Bo8g055830 I 0.422
Bo3g037630 Brassica oleracea Bo3g037630 I 0.416
Bo8g112450 Brassica oleracea Bo8g112450 I 0.416
Bra003309 Brassica rapa Bra003309 I 0.416
Bra000538 Brassica rapa Bra000538 I 0.416
Bra004364 Brassica rapa Bra004364 I 0.416
Bra018624 Brassica rapa Bra018624 I 0.416
Bra030728 Brassica rapa Bra030728 I 0.416
Bra031629 Brassica rapa Bra031629 I 0.416
Bra037320 Brassica rapa Bra037320 I 0.416
Bra040322 Brassica rapa Bra040322 I 0.416
Bra000378 Brassica rapa Bra000378 I 0.416
CBN09380 Caenorhabditis brenneri CBN09380 N 0.625
Y73E7A.1 Caenorhabditis elegans WBGene00022268 N 0.630
CJA05209 Caenorhabditis japonica CJA05209 N 0.625
CRE03905 Caenorhabditis remanei CRE03905 N 0.625
Cflo_06133--XP_394373.1_APIME Camponotus floridanus Cflo_06133--XP_394373.1_APIME I 0.661
PK13838.1 Cannabis sativa PK13838.1 I 0.416
PK09461.1 Cannabis sativa PK09461.1 I 0.416
PK06964.1 Cannabis sativa PK06964.1 I 0.416
CapteG224864 Capitella teleta CapteG224864 I 0.676
Cagra.4395s0036 Capsella grandiflora Cagra.4395s0036 I 0.416
Cagra.1261s0010 Capsella grandiflora Cagra.1261s0010 I 0.416
Cagra.11302s0003 Capsella grandiflora Cagra.11302s0003 I 0.416
Cagra.0605s0067 Capsella grandiflora Cagra.0605s0067 I 0.427
Cagra.0537s0004 Capsella grandiflora Cagra.0537s0004 I 0.416
Cagra.0239s0072 Capsella grandiflora Cagra.0239s0072 I 0.416
Carubv10024208m.g Capsella rubella Carubv10024208m.g I 0.416
Carubv10021641m.g Capsella rubella Carubv10021641m.g I 0.416
Carubv10012024m.g Capsella rubella Carubv10012024m.g I 0.427
Carubv10010384m.g Capsella rubella Carubv10010384m.g I 0.416
Carubv10024011m.g Capsella rubella Carubv10024011m.g I 0.416
Carubv10001833m.g Capsella rubella Carubv10001833m.g I 0.416
evm.TU.contig_30608 Carica papaya evm.TU.contig_30608 I 0.416
evm.TU.supercontig_103.34 Carica papaya evm.TU.supercontig_103.34 I 0.416
evm.TU.supercontig_104.5 Carica papaya evm.TU.supercontig_104.5 I 0.416
evm.TU.supercontig_145.3 Carica papaya evm.TU.supercontig_145.3 I 0.416
evm.TU.supercontig_29.121 Carica papaya evm.TU.supercontig_29.121 I 0.416
evm.TU.supercontig_46.14 Carica papaya evm.TU.supercontig_46.14 I 0.416
fgeneshCV_pg.C_scaffold_2000022 Chlorella vulgaris fgeneshCV_pg.C_scaffold_2000022 N 0.463
Ca_06681 Cicer arietinum Ca_06681 I 0.416
Ca_07101 Cicer arietinum Ca_07101 I 0.416
Ca_18533 Cicer arietinum Ca_18533 I 0.416
Ca_25981 Cicer arietinum Ca_25981 I 0.416
Ca_12379 Cicer arietinum Ca_12379 I 0.416
CLEC002888 Cimex lectularius CLEC002888 N 0.566
CLEC000086 Cimex lectularius CLEC000086 N 0.501
ENSCING00000023833 Ciona intestinalis ENSCING00000023833 N 0.481
Cla012424 Citrullus lanatus Cla012424 I 0.416
Cla016962 Citrullus lanatus Cla016962 I 0.416
Cla010397 Citrullus lanatus Cla010397 I 0.416
Cla008752 Citrullus lanatus Cla008752 I 0.416
Cla011745 Citrullus lanatus Cla011745 I 0.416
Ciclev10009560m.g Citrus clementina Ciclev10009560m.g I 0.416
Ciclev10021834m.g Citrus clementina Ciclev10021834m.g I 0.416
Ciclev10029354m.g Citrus clementina Ciclev10029354m.g I 0.416
Ciclev10022170m.g Citrus clementina Ciclev10022170m.g I 0.416
orange1.1g029862m.g Citrus sinensis orange1.1g029862m.g I 0.416
orange1.1g027215m.g Citrus sinensis orange1.1g027215m.g I 0.416
orange1.1g028144m.g Citrus sinensis orange1.1g028144m.g I 0.416
orange1.1g028980m.g Citrus sinensis orange1.1g028980m.g I 0.416
fgenesh1_pm.2_#_13 Coccomyxa subellipsoidea C169 fgenesh1_pm.2_#_13 N 0.463
CGI_10019404 Crassostrea gigas CGI_10019404 N 0.587
CMU_009510 Cryptosporidium muris CMU_009510 N 0.429
cgd2_870 Cryptosporidium parvum cgd2_870 N 0.416
Cucsa.086660 Cucumis sativus Cucsa.086660 I 0.416
Cucsa.132170 Cucumis sativus Cucsa.132170 I 0.416
Cucsa.284430 Cucumis sativus Cucsa.284430 I 0.416
Cucsa.295080 Cucumis sativus Cucsa.295080 I 0.416
Cucsa.320600 Cucumis sativus Cucsa.320600 I 0.416
Cucsa.302100 Cucumis sativus Cucsa.302100 I 0.416
CpipJ_CPIJ005084 Culex pipiens CpipJ_CPIJ005084 N 0.595
CPIJ005084 Culex quinquefasciatus CPIJ005084 N 0.595
KGM_20190 Danaus plexippus KGM_20190 I 0.680
DAPPUDRAFT_303074 Daphnia pulex DAPPUDRAFT_303074 N 0.646
DICVIV_03175 Dictyocaulus viviparus DICVIV_03175 N 0.635
DILT_0001250601 Diphyllobothrium latum DILT_0001250601 N 0.499
GH18160 Drosophila grimshawi FBgn0125628 I 0.587
GK13574 Drosophila willistoni FBgn0215582 I 0.587
GE25578 Drosophila yakuba FBgn0242642 I 0.587
ECPE_0001800901 Echinostoma caproni ECPE_0001800901 N 0.448
ETH_00032160 Eimeria tenella ETH_00032160 N 0.460
Eucgr.B03140 Eucalyptus grandis Eucgr.B03140 I 0.416
Eucgr.C01515 Eucalyptus grandis Eucgr.C01515 I 0.416
Eucgr.D02474 Eucalyptus grandis Eucgr.D02474 I 0.416
Eucgr.J00587 Eucalyptus grandis Eucgr.J00587 I 0.416
Eucgr.E01474 Eucalyptus grandis Eucgr.E01474 I 0.416
Thhalv10019126m.g Eutrema salsugineum Thhalv10019126m.g I 0.416
Thhalv10028925m.g Eutrema salsugineum Thhalv10028925m.g I 0.416
Thhalv10008858m.g Eutrema salsugineum Thhalv10008858m.g I 0.416
Thhalv10001617m.g Eutrema salsugineum Thhalv10001617m.g I 0.416
Thhalv10017320m.g Eutrema salsugineum Thhalv10017320m.g I 0.416
gene03938-v1.0-hybrid Fragaria vesca gene03938-v1.0-hybrid I 0.416
gene04566-v1.0-hybrid Fragaria vesca gene04566-v1.0-hybrid I 0.416
gene32251-v1.0-hybrid Fragaria vesca gene32251-v1.0-hybrid I 0.416
gene31056-v1.0-hybrid Fragaria vesca gene31056-v1.0-hybrid I 0.416
GLYMA17G14710 Glycine max GLYMA17G14710 I 0.416
GLYMA01G33370 Glycine max GLYMA01G33370 I 0.416
GLYMA02G13350 Glycine max GLYMA02G13350 I 0.416
GLYMA03G03500 Glycine max GLYMA03G03500 I 0.416
GLYMA08G39290 Glycine max GLYMA08G39290 I 0.431
GLYMA13G22620 Glycine max GLYMA13G22620 I 0.416
GLYMA04G10125 Glycine max GLYMA04G10125 I 0.431
GLYMA05G04260 Glycine max GLYMA05G04260 I 0.416
GLYMA12G10210 Glycine max GLYMA12G10210 I 0.416
GLYMA06G46560 Glycine max GLYMA06G46560 I 0.416
GLYMA17G12200 Glycine max GLYMA17G12200 I 0.416
GLYMA12G31670 Glycine max GLYMA12G31670 I 0.416
GLYMA01G08030 Glycine max GLYMA01G08030 I 0.416
GLYMA13G38750 Glycine max GLYMA13G38750 I 0.416
GLYMA18G19720 Glycine max GLYMA18G19720 I 0.431
GPUH_0000676401 Gongylonema pulchrum GPUH_0000676401 N 0.665
Gorai.008G236500 Gossypium raimondii Gorai.008G236500 I 0.416
Gorai.001G042700 Gossypium raimondii Gorai.001G042700 I 0.416
Gorai.009G016700 Gossypium raimondii Gorai.009G016700 I 0.416
Gorai.001G174800 Gossypium raimondii Gorai.001G174800 I 0.416
Gorai.010G062900 Gossypium raimondii Gorai.010G062900 I 0.416
Gorai.006G117800 Gossypium raimondii Gorai.006G117800 I 0.416
Gorai.001G127000 Gossypium raimondii Gorai.001G127000 I 0.416
Gorai.005G146700 Gossypium raimondii Gorai.005G146700 I 0.416
GUITHDRAFT_162866 Guillardia theta GUITHDRAFT_162866 N 0.516
HCOI00594600 Haemonchus contortus HCOI00594600 N 0.635
HPLM_0000348901 Haemonchus placei HPLM_0000348901 N 0.635
HHAL005242-PA Halyomorpha halys HHAL005242-PA I 0.672
Hsal_04778--XP_394373.1_APIME Harpegnathos saltator Hsal_04778--XP_394373.1_APIME I 0.683
HMEL009197 Heliconius melpomene HMEL009197 N 0.635
HPBE_0001252601 Heligmosomoides bakeri HPBE_0001252601 N 0.635
HelroG66455 Helobdella robusta HelroG66455 N 0.667
MLOC_60897 Hordeum vulgare MLOC_60897 I 0.416
MLOC_70676 Hordeum vulgare MLOC_70676 I 0.416
MLOC_66260 Hordeum vulgare MLOC_66260 I 0.416
MLOC_70653 Hordeum vulgare MLOC_70653 I 0.416
ISCW011313 Ixodes scapularis ISCW011313 N 0.659
LPERR04G16190 Leersia perrieri LPERR04G16190 I 0.416
LPERR03G22960 Leersia perrieri LPERR03G22960 I 0.416
LPERR10G11580 Leersia perrieri LPERR10G11580 I 0.416
LPERR02G20990 Leersia perrieri LPERR02G20990 I 0.416
LPERR07G03250 Leersia perrieri LPERR07G03250 I 0.416
Lus10024603.g Linum usitatissimum Lus10024603.g I 0.420
Lus10029135.g Linum usitatissimum Lus10029135.g I 0.431
Lus10032240.g Linum usitatissimum Lus10032240.g I 0.420
Lus10019407.g Linum usitatissimum Lus10019407.g I 0.416
Lus10013028.g Linum usitatissimum Lus10013028.g I 0.431
Lus10036811.g Linum usitatissimum Lus10036811.g I 0.416
Lus10036496.g Linum usitatissimum Lus10036496.g I 0.416
Lus10010361.g Linum usitatissimum Lus10010361.g I 0.416
LotgiG126557 Lottia gigantea LotgiG126557 N 0.596
LjSGA_107961.1 Lotus japonicus LjSGA_107961.1 I 0.416
LCUP006380 Lucilia cuprina LCUP006380 N 0.542
MDP0000192940 Malus domestica MDP0000192940 I 0.416
MDP0000291729 Malus domestica MDP0000291729 I 0.416
MDP0000124879 Malus domestica MDP0000124879 I 0.416
MDP0000255415 Malus domestica MDP0000255415 I 0.416
MDP0000500810 Malus domestica MDP0000500810 I 0.416
MDP0000366291 Malus domestica MDP0000366291 I 0.416
MDP0000331808 Malus domestica MDP0000331808 I 0.416
MDP0000298333 Malus domestica MDP0000298333 I 0.416
MDP0000252640 Malus domestica MDP0000252640 I 0.416
MDP0000171878 Malus domestica MDP0000171878 I 0.416
cassava26804.m1 Manihot esculenta cassava26804.m1 I 0.427
cassava40986.m1 Manihot esculenta cassava40986.m1 I 0.416
cassava39022.m1 Manihot esculenta cassava39022.m1 I 0.416
cassava33847.m1 Manihot esculenta cassava33847.m1 I 0.416
cassava17722.valid.m1 Manihot esculenta cassava17722.valid.m1 I 0.416
cassava13963.valid.m1 Manihot esculenta cassava13963.valid.m1 I 0.416
cassava13510.valid.m1 Manihot esculenta cassava13510.valid.m1 I 0.416
cassava13509.valid.m1 Manihot esculenta cassava13509.valid.m1 I 0.416
cassava10710.m1 Manihot esculenta cassava10710.m1 I 0.416
cassava39135.m1 Manihot esculenta cassava39135.m1 I 0.416
cassava43469.valid.m1 Manihot esculenta cassava43469.valid.m1 I 0.416
cassava30083.valid.m1 Manihot esculenta cassava30083.valid.m1 I 0.416
MTR_4g101660 Medicago truncatula MTR_4g101660 I 0.416
MTR_4g050300 Medicago truncatula MTR_4g050300 I 0.416
MTR_4g025900 Medicago truncatula MTR_4g025900 I 0.416
MTR_2g087740 Medicago truncatula MTR_2g087740 I 0.416
MTR_4g114730 Medicago truncatula MTR_4g114730 I 0.416
MCINX012524 Melitaea cinxia MCINX012524 I 0.674
maker-nMf.1.1.scaf18285-snap-gene-0.4 Meloidogyne floridensis maker-nMf.1.1.scaf18285-snap-gene-0.4 N 0.635
MhA1_Contig1250.frz3.gene10 Meloidogyne hapla MhA1_Contig1250.frz3.gene10 N 0.635
Minc12734 Meloidogyne incognita Minc12734 N 0.635
mgf015806m Mimulus guttatus mgf015806m I 0.416
mgf010765m Mimulus guttatus mgf010765m I 0.416
mgf007067m Mimulus guttatus mgf007067m I 0.416
mgf003166m Mimulus guttatus mgf003166m I 0.416
mgf011463m Mimulus guttatus mgf011463m I 0.416
mgf019496m Mimulus guttatus mgf019496m I 0.450
mgf015972m Mimulus guttatus mgf015972m I 0.416
mgf009982m Mimulus guttatus mgf009982m I 0.416
mgf001016m Mimulus guttatus mgf001016m I 0.416
ML11467a Mnemiopsis leidyi ML11467a N 0.503
GSMUA_Achr3G30800_001 Musa acuminata GSMUA_Achr3G30800_001 I 0.420
GSMUA_Achr8G04750_001 Musa acuminata GSMUA_Achr8G04750_001 I 0.427
GSMUA_Achr8G11580_001 Musa acuminata GSMUA_Achr8G11580_001 I 0.416
GSMUA_Achr8G26600_001 Musa acuminata GSMUA_Achr8G26600_001 I 0.427
GSMUA_AchrUn_randomG19410_001 Musa acuminata GSMUA_AchrUn_randomG19410_001 I 0.427
GSMUA_Achr7G01330_001 Musa acuminata GSMUA_Achr7G01330_001 I 0.416
GSMUA_Achr11G17520_001 Musa acuminata GSMUA_Achr11G17520_001 I 0.416
GSMUA_Achr7G07830_001 Musa acuminata GSMUA_Achr7G07830_001 I 0.416
GSMUA_Achr6G31080_001 Musa acuminata GSMUA_Achr6G31080_001 I 0.416
GSMUA_Achr7G07130_001 Musa acuminata GSMUA_Achr7G07130_001 I 0.416
GSMUA_Achr3G15060_001 Musa acuminata GSMUA_Achr3G15060_001 I 0.427
GSMUA_Achr4G22750_001 Musa acuminata GSMUA_Achr4G22750_001 I 0.416
GSMUA_Achr2G12850_001 Musa acuminata GSMUA_Achr2G12850_001 I 0.416
GSMUA_Achr4G31310_001 Musa acuminata GSMUA_Achr4G31310_001 I 0.416
GSMUA_Achr11G03800_001 Musa acuminata GSMUA_Achr11G03800_001 I 0.416
MDOA001488 Musca domestica MDOA001488 I 0.638
NV13812 Nasonia vitripennis NV13812 I 0.701
NECAME_12352 Necator americanus NECAME_12352 N 0.624
NCLIV_051130 Neospora caninum NCLIV_051130 N 0.423
NBR_0000605501 Nippostrongylus brasiliensis NBR_0000605501 N 0.635
Ocbimv22013575m.g Octopus bimaculoides Ocbimv22013575m.g I 0.692
OESDEN_05486 Oesophagostomum dentatum OESDEN_05486 N 0.624
OBART03G27740 Oryza barthii OBART03G27740 I 0.416
OBART04G20010 Oryza barthii OBART04G20010 I 0.416
OBART10G15260 Oryza barthii OBART10G15260 I 0.416
OBART12G19190 Oryza barthii OBART12G19190 I 0.416
OBART02G25670 Oryza barthii OBART02G25670 I 0.416
OB12G26050 Oryza brachyantha OB12G26050 I 0.416
OB02G33040 Oryza brachyantha OB02G33040 I 0.416
OB03G35470 Oryza brachyantha OB03G35470 I 0.416
OB07G12810 Oryza brachyantha OB07G12810 I 0.416
OB04G27010 Oryza brachyantha OB04G27010 I 0.416
ORGLA04G0171000 Oryza glaberrima ORGLA04G0171000 I 0.416
ORGLA12G0165000 Oryza glaberrima ORGLA12G0165000 I 0.416
ORGLA02G0220100 Oryza glaberrima ORGLA02G0220100 I 0.416
OGLUM02G26190 Oryza glumaepatula OGLUM02G26190 I 0.416
OGLUM03G28370 Oryza glumaepatula OGLUM03G28370 I 0.416
OGLUM04G19890 Oryza glumaepatula OGLUM04G19890 I 0.416
OGLUM10G15140 Oryza glumaepatula OGLUM10G15140 I 0.416
OGLUM12G20870 Oryza glumaepatula OGLUM12G20870 I 0.416
BGIOSGA013223 Oryza indica BGIOSGA013223 I 0.416
BGIOSGA037817 Oryza indica BGIOSGA037817 I 0.416
BGIOSGA014650 Oryza indica BGIOSGA014650 I 0.416
OLONG_018621 Oryza longistaminata OLONG_018621 I 0.416
OLONG_018568 Oryza longistaminata OLONG_018568 I 0.416
OMERI04G17000 Oryza meridionalis OMERI04G17000 I 0.416
OMERI07G02330 Oryza meridionalis OMERI07G02330 I 0.416
OMERI10G11950 Oryza meridionalis OMERI10G11950 I 0.416
OMERI12G13460 Oryza meridionalis OMERI12G13460 I 0.416
OMERI02G25190 Oryza meridionalis OMERI02G25190 I 0.416
ONIVA03G28660 Oryza nivara ONIVA03G28660 I 0.416
ONIVA02G03100 Oryza nivara ONIVA02G03100 I 0.416
ONIVA04G18220 Oryza nivara ONIVA04G18220 I 0.416
ONIVA04G21490 Oryza nivara ONIVA04G21490 I 0.416
ONIVA02G28110 Oryza nivara ONIVA02G28110 I 0.416
OPUNC10G13730 Oryza punctata OPUNC10G13730 I 0.416
OPUNC12G17340 Oryza punctata OPUNC12G17340 I 0.416
OPUNC02G23520 Oryza punctata OPUNC02G23520 I 0.416
OPUNC03G25290 Oryza punctata OPUNC03G25290 I 0.416
OPUNC07G03670 Oryza punctata OPUNC07G03670 I 0.416
ORUFI02G27080 Oryza rufipogon ORUFI02G27080 I 0.416
ORUFI03G28820 Oryza rufipogon ORUFI03G28820 I 0.416
ORUFI04G21570 Oryza rufipogon ORUFI04G21570 I 0.416
ORUFI07G03450 Oryza rufipogon ORUFI07G03450 I 0.416
ORUFI10G16240 Oryza rufipogon ORUFI10G16240 I 0.416
ORUFI12G21410 Oryza rufipogon ORUFI12G21410 I 0.416
YAB1 Oryza sativa OS07G0160100 I 0.416
YAB3 Oryza sativa OS10G0508300 I 0.416
YAB2 Oryza sativa OS03G0650000 I 0.416
YAB4 Oryza sativa OS02G0643200 I 0.416
YAB6 Oryza sativa OS12G0621100 I 0.416
YAB5 Oryza sativa OS04G0536300 I 0.416
ccdc124 Oryzias latipes ENSORLG00000015728 N 0.536
Pavir.Ab02534 Panicum virgatum Pavir.Ab02534 I 0.416
Pavir.Ba03779 Panicum virgatum Pavir.Ba03779 I 0.416
Pavir.Ca02862 Panicum virgatum Pavir.Ca02862 I 0.416
Pavir.Cb00070 Panicum virgatum Pavir.Cb00070 I 0.416
Pavir.Ga00891 Panicum virgatum Pavir.Ga00891 I 0.416
Pavir.Ib03707 Panicum virgatum Pavir.Ib03707 I 0.416
Pavir.Gb00743 Panicum virgatum Pavir.Gb00743 I 0.416
Pavir.Ia01130 Panicum virgatum Pavir.Ia01130 I 0.416
Pavir.Aa01223 Panicum virgatum Pavir.Aa01223 I 0.416
Pavir.Ib04136 Panicum virgatum Pavir.Ib04136 I 0.416
PEQ_0000413701 Parascaris equorum PEQ_0000413701 N 0.670
PHUM036320 Pediculus humanus PHUM036320 N 0.613
estExt_fgenesh1_kg.C_80399 Phytophthora capsici estExt_fgenesh1_kg.C_80399 N 0.567
fgenesh1_pg.C_scaffold_73784000001 Phytophthora capsici fgenesh1_pg.C_scaffold_73784000001 N 0.567
fgenesh_scip_prom.46568.2049 Phytophthora kernoviae fgenesh_scip_prom.46568.2049 N 0.567
fgenesh_scip_prom.28083.7036 Phytophthora lateralis fgenesh_scip_prom.28083.7036 N 0.541
F443_19335 Phytophthora parasitica F443_19335 N 0.567
Phyra74523 Phytophthora ramorum Phyra74523 N 0.541
Physo132366 Phytophthora sojae Physo132366 N 0.567
POPTR_0002s14600 Populus trichocarpa POPTR_0002s14600 I 0.416
YAB2 Populus trichocarpa POPTR_0001s22180 I 0.416
POPTR_0003s11230 Populus trichocarpa POPTR_0003s11230 I 0.416
POPTR_0006s06700 Populus trichocarpa POPTR_0006s06700 I 0.416
POPTR_0016s06760 Populus trichocarpa POPTR_0016s06760 I 0.416
POPTR_0010s05220 Populus trichocarpa POPTR_0010s05220 I 0.431
POPTR_0001s00240 Populus trichocarpa POPTR_0001s00240 I 0.416
POPTR_0018s12990 Populus trichocarpa POPTR_0018s12990 I 0.416
POPTR_0008s19330 Populus trichocarpa POPTR_0008s19330 I 0.420
POPTR_0014s06210 Populus trichocarpa POPTR_0014s06210 I 0.416
Pm001547 Prunus mume Pm001547 I 0.416
Pm030598 Prunus mume Pm030598 I 0.416
Pm027559 Prunus mume Pm027559 I 0.416
Pm023555 Prunus mume Pm023555 I 0.416
Pm006709 Prunus mume Pm006709 I 0.431
Pm017846 Prunus mume Pm017846 I 0.416
PRUPE_ppa011209mg Prunus persica PRUPE_ppa011209mg I 0.416
PRUPE_ppa012028mg Prunus persica PRUPE_ppa012028mg I 0.416
PRUPE_ppa014900mg Prunus persica PRUPE_ppa014900mg I 0.416
PRUPE_ppa011880m2g Prunus persica PRUPE_ppa011880m2g I 0.416
PRUPE_ppa023883mg Prunus persica PRUPE_ppa023883mg I 0.431
PRUPE_ppa010905mg Prunus persica PRUPE_ppa010905mg I 0.416
maker-pir_contig_430-fgenesh-gene-0.3 Pythium irregulare maker-pir_contig_430-fgenesh-gene-0.3 N 0.578
maker-piw_contig_1911-snap-gene-0.6 Pythium iwayamai maker-piw_contig_1911-snap-gene-0.6 N 0.578
PYU1_G003004 Pythium ultimum PYU1_G003004 N 0.578
maker-pve_contig_105-snap-gene-0.29 Pythium vexans maker-pve_contig_105-snap-gene-0.29 N 0.534
RPRC009760 Rhodnius prolixus RPRC009760 N 0.601
29927.m000626 Ricinus communis 29927.m000626 I 0.416
30174.m009083 Ricinus communis 30174.m009083 I 0.416
30174.m008839 Ricinus communis 30174.m008839 I 0.416
29854.m001136 Ricinus communis 29854.m001136 I 0.416
28200.m000191 Ricinus communis 28200.m000191 I 0.416
SapurV1A.1100s0080 Salix purpurea SapurV1A.1100s0080 I 0.416
SapurV1A.0258s0090 Salix purpurea SapurV1A.0258s0090 I 0.416
SapurV1A.0248s0170 Salix purpurea SapurV1A.0248s0170 I 0.420
SapurV1A.0217s0100 Salix purpurea SapurV1A.0217s0100 I 0.416
SapurV1A.0034s0500 Salix purpurea SapurV1A.0034s0500 I 0.416
SapurV1A.0069s0070 Salix purpurea SapurV1A.0069s0070 I 0.431
SapurV1A.0269s0230 Salix purpurea SapurV1A.0269s0230 I 0.431
SapurV1A.0288s0210 Salix purpurea SapurV1A.0288s0210 I 0.416
SapurV1A.0634s0130 Salix purpurea SapurV1A.0634s0130 I 0.416
SapurV1A.1275s0050 Salix purpurea SapurV1A.1275s0050 I 0.416
SapurV1A.2672s0010 Salix purpurea SapurV1A.2672s0010 I 0.416
SapurV1A.3336s0010 Salix purpurea SapurV1A.3336s0010 I 0.416
SapurV1A.0033s0530 Salix purpurea SapurV1A.0033s0530 I 0.416
SPRG_06372 Saprolegnia parasitica SPRG_06372 N 0.578
A_06553 Schistosoma haematobium A_06553 N 0.541
Sjc_0011880 Schistosoma japonicum Sjc_0011880 N 0.548
Smp_004360 Schistosoma mansoni Smp_004360 N 0.541
SMRZ_0002114501 Schistosoma margrebowiei SMRZ_0002114501 N 0.541
Si010859m.g Setaria italica Si010859m.g I 0.416
Si018146m.g Setaria italica Si018146m.g I 0.416
Si023308m.g Setaria italica Si023308m.g I 0.416
Si030811m.g Setaria italica Si030811m.g I 0.416
Si036788m.g Setaria italica Si036788m.g I 0.416
Si037789m.g Setaria italica Si037789m.g I 0.416
SBAD_0000307901 Soboliphyme baturini SBAD_0000307901 N 0.576
Solyc05g012050.2 Solanum lycopersicum Solyc05g012050.2 I 0.420
Solyc01g091010.2 Solanum lycopersicum Solyc01g091010.2 I 0.416
Solyc12g009580.1 Solanum lycopersicum Solyc12g009580.1 I 0.416
Solyc11g071810.1 Solanum lycopersicum Solyc11g071810.1 I 0.416
Solyc08g079100.2 Solanum lycopersicum Solyc08g079100.2 I 0.416
Solyc07g008180.2 Solanum lycopersicum Solyc07g008180.2 I 0.416
Solyc06g073920.2 Solanum lycopersicum Solyc06g073920.2 I 0.416
PGSC0003DMG400002883 Solanum tuberosum PGSC0003DMG400002883 I 0.416
PGSC0003DMG400002988 Solanum tuberosum PGSC0003DMG400002988 I 0.416
PGSC0003DMG400004741 Solanum tuberosum PGSC0003DMG400004741 I 0.416
PGSC0003DMG400005936 Solanum tuberosum PGSC0003DMG400005936 I 0.416
PGSC0003DMG400025969 Solanum tuberosum PGSC0003DMG400025969 I 0.416
PGSC0003DMG400030904 Solanum tuberosum PGSC0003DMG400030904 I 0.416
PGSC0003DMG400028360 Solanum tuberosum PGSC0003DMG400028360 I 0.420
SINV12391 Solenopsis invicta SINV12391 I 0.683
Sb04g033590 Sorghum bicolor Sb04g033590 I 0.416
Sb01g013270 Sorghum bicolor Sb01g013270 I 0.416
Sb01g017560 Sorghum bicolor Sb01g017560 I 0.416
Sb02g003390 Sorghum bicolor Sb02g003390 I 0.416
Sb06g023770 Sorghum bicolor Sb06g023770 I 0.416
Sb08g022030 Sorghum bicolor Sb08g022030 I 0.416
SPU_001776 Strongylocentrotus purpuratus SPU_001776 N 0.556
TELCIR_11967 Teladorsagia circumcincta TELCIR_11967 N 0.635
tetur18g00680 Tetranychus urticae tetur18g00680 I 0.640
TCLT_0001081001 Thelazia callipaeda TCLT_0001081001 N 0.665
TCM_041175 Theobroma cacao TCM_041175 I 0.416
TCM_005549 Theobroma cacao TCM_005549 I 0.416
TCM_016030 Theobroma cacao TCM_016030 I 0.416
TCM_038105 Theobroma cacao TCM_038105 I 0.416
TCM_011484 Theobroma cacao TCM_011484 I 0.416
TGME49_037260 Toxoplasma gondii TGME49_037260 N 0.460
TC004658 Tribolium castaneum TC004658 N 0.559
D917_07703 Trichinella nativa D917_07703 N 0.518
EFV51436 Trichinella spiralis EFV51436 N 0.518
TRE_0001918901 Trichobilharzia regenti TRE_0001918901 N 0.561
D918_07944 Trichuris suis D918_07944 N 0.474
TTRE_0000309701 Trichuris trichiura TTRE_0000309701 N 0.457
Traes_5BL_4DEC298F9 Triticum aestivum Traes_5BL_4DEC298F9 I 0.416
Traes_1DL_C5AF9D06A Triticum aestivum Traes_1DL_C5AF9D06A I 0.416
Traes_2AL_71DE02042 Triticum aestivum Traes_2AL_71DE02042 I 0.416
Traes_5AL_EB97D69D7 Triticum aestivum Traes_5AL_EB97D69D7 I 0.416
Traes_2BL_8BEA9CE1B Triticum aestivum Traes_2BL_8BEA9CE1B I 0.416
Traes_5AS_31C2540C0 Triticum aestivum Traes_5AS_31C2540C0 I 0.416
Traes_6DL_59DB06B9F Triticum aestivum Traes_6DL_59DB06B9F I 0.416
Traes_6BL_3F8DB6043 Triticum aestivum Traes_6BL_3F8DB6043 I 0.416
Traes_6AL_2983D4EB6 Triticum aestivum Traes_6AL_2983D4EB6 I 0.416
Traes_5DS_268147383 Triticum aestivum Traes_5DS_268147383 I 0.416
Traes_5DL_0E369E1FC Triticum aestivum Traes_5DL_0E369E1FC I 0.416
Traes_5BS_A782F7510 Triticum aestivum Traes_5BS_A782F7510 I 0.416
TRIUR3_29073 Triticum urartu TRIUR3_29073 I 0.416
TRIUR3_27479 Triticum urartu TRIUR3_27479 I 0.416
TRIUR3_27402 Triticum urartu TRIUR3_27402 I 0.416
TRIUR3_18590 Triticum urartu TRIUR3_18590 I 0.416
VIT_15s0048g00550 Vitis vinifera VIT_15s0048g00550 I 0.416
YAB5 Vitis vinifera VIT_11s0016g05590 I 0.416
YAB2 Vitis vinifera VIT_06s0009g00880 I 0.416
VIT_02s0154g00070 Vitis vinifera VIT_02s0154g00070 I 0.416
CRC Vitis vinifera VIT_01s0011g00140 I 0.416
INO Vitis vinifera VIT_01s0127g00330 I 0.431
VIT_08s0032g01110 Vitis vinifera VIT_08s0032g01110 I 0.416
GRMZM2G005353 Zea mays GRMZM2G005353 I 0.416
GRMZM2G529859 Zea mays GRMZM2G529859 I 0.416
GRMZM2G167824 Zea mays GRMZM2G167824 I 0.416
GRMZM2G141955 Zea mays GRMZM2G141955 I 0.416
GRMZM2G116646 Zea mays GRMZM2G116646 I 0.416
GRMZM2G106204 Zea mays GRMZM2G106204 I 0.416
GRMZM2G085873 Zea mays GRMZM2G085873 I 0.416
GRMZM2G074124 Zea mays GRMZM2G074124 I 0.416
GRMZM2G054795 Zea mays GRMZM2G054795 I 0.416
GRMZM2G074543 Zea mays GRMZM2G074543 I 0.416