OPUNC03G08080 (Oryza punctata)
Sox

TF Information

Pfam ID Interpro ID Gene ID CIS-BP ID Sequence source Animal TF db
PF00505 (HMG_box) IPR000910 OPUNC03G08080 T331660_2.00 Ensembl (2018-Dec-8) Link out

Directly determined binding motifs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
No direct experiments

Motifs from related TFs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
CRC
M07266_2.00
Arabidopsis thaliana
TWATCATW

WATGATWA
Dap-seq
OMalley et al.(2016)
CRC_col_a
0.673 0.800
CRC
M07267_2.00
Arabidopsis thaliana
GGTTAGTGTTTTGGAGTCGAATATGACTTG

CAAGTCATATTCGACTCCAAAACACTAACC
Dap-seq
OMalley et al.(2016)
CRC_colamp_a
0.673 0.800
YAB1
M00890_2.00
Arabidopsis thaliana
AATAATWA

TWATTATT
PBM
Franco-Zorrilla et al.(2014)
YAB1
0.657 0.689
YAB5
M02486_2.00
Arabidopsis thaliana
NNNNHRN

NYDNNNN
PBM
Weirauch et al.(2014)
pTH7575
0.627 0.667
YAB5
M00889_2.00
Arabidopsis thaliana
NATRATTADNNN

NNNHTAATYATN
PBM
Franco-Zorrilla et al.(2014)
YAB5
0.627 0.667
INO
M02485_2.00
Arabidopsis thaliana
NHNNNYRNNN

NNNYRNNNDN
PBM
Weirauch et al.(2014)
pTH7516
0.556 0.578
For this family, TFs with SR scores > 0.415 will likely have a similar motif

DNA Binding Domains

Protein ID Domain From To Sequence
OPUNC03G08080.1 Sox 105 149

Links

Other Sox family TFs
Other Oryza punctata TFs

501 Related TFs

Name Species Gene ID Motif Evidence SR
Score
Action
27538.m000327 Ricinus communis 27538.m000327 I 0.000
29908.m005953 Ricinus communis 29908.m005953 I 0.000
30078.m002329 Ricinus communis 30078.m002329 I 0.000
AC207656.3_FG002 Zea mays AC207656.3_FG002 I 0.000
ARF17 Arabidopsis thaliana AT1G77850 N 0.000
ARF16 Arabidopsis thaliana AT4G30080 D 0.000
BGIOSGA008657 Oryza indica BGIOSGA008657 I 0.000
BGIOSGA014036 Oryza indica BGIOSGA014036 N 0.000
ARF10 Oryza indica BGIOSGA016767 I 0.000
BGIOSGA033142 Oryza indica BGIOSGA033142 I 0.000
Bo1g014600 Brassica oleracea Bo1g014600 I 0.000
Bo6g081980 Brassica oleracea Bo6g081980 N 0.000
Bo6g121520 Brassica oleracea Bo6g121520 N 0.000
Bo7g114200 Brassica oleracea Bo7g114200 I 0.000
Bostr.20129s0222 Boechera stricta Bostr.20129s0222 N 0.000
Bostr.7867s0859 Boechera stricta Bostr.7867s0859 I 0.000
Bra003665 Brassica rapa Bra003665 N 0.000
Bra011162 Brassica rapa Bra011162 I 0.000
Bra015651 Brassica rapa Bra015651 N 0.000
Bra024109 Brassica rapa Bra024109 I 0.000
BRADI1G33160 Brachypodium distachyon BRADI1G33160 I 0.000
BRADI3G28950 Brachypodium distachyon BRADI3G28950 I 0.000
BRADI3G49320 Brachypodium distachyon BRADI3G49320 I 0.000
BRADI5G27400 Brachypodium distachyon BRADI5G27400 N 0.000
Cagra.0096s0050 Capsella grandiflora Cagra.0096s0050 N 0.000
Cagra.1744s0020 Capsella grandiflora Cagra.1744s0020 I 0.000
Carubv10004220m.g Capsella rubella Carubv10004220m.g I 0.000
Carubv10019991m.g Capsella rubella Carubv10019991m.g N 0.000
cassava23558.valid.m1 Manihot esculenta cassava23558.valid.m1 I 0.000
cassava36161.valid.m1 Manihot esculenta cassava36161.valid.m1 I 0.000
cassava5984.valid.m1 Manihot esculenta cassava5984.valid.m1 I 0.000
cassava852.valid.m1 Manihot esculenta cassava852.valid.m1 I 0.000
Ca_02541 Cicer arietinum Ca_02541 I 0.000
Ca_26121 Cicer arietinum Ca_26121 I 0.000
chr1.LjT31L11.90.nd Lotus japonicus chr1.LjT31L11.90.nd I 0.000
chr3.LjT10E18.60.nc Lotus japonicus chr3.LjT10E18.60.nc I 0.000
Ciclev10000693m.g Citrus clementina Ciclev10000693m.g I 0.000
Ciclev10011194m.g Citrus clementina Ciclev10011194m.g I 0.000
Ciclev10030860m.g Citrus clementina Ciclev10030860m.g I 0.000
Cla008883 Citrullus lanatus Cla008883 I 0.000
Cla018574 Citrullus lanatus Cla018574 I 0.000
Cla022413 Citrullus lanatus Cla022413 I 0.000
Cucsa.124410 Cucumis sativus Cucsa.124410 I 0.000
Cucsa.137650 Cucumis sativus Cucsa.137650 I 0.000
Cucsa.381330 Cucumis sativus Cucsa.381330 I 0.000
Cucsa.386060 Cucumis sativus Cucsa.386060 I 0.000
Eucgr.F04380 Eucalyptus grandis Eucgr.F04380 I 0.000
Eucgr.J00923 Eucalyptus grandis Eucgr.J00923 I 0.000
Eucgr.K01240 Eucalyptus grandis Eucgr.K01240 I 0.000
evm.TU.supercontig_49.122 Carica papaya evm.TU.supercontig_49.122 I 0.000
evm.TU.supercontig_53.88 Carica papaya evm.TU.supercontig_53.88 I 0.000
evm.TU.supercontig_65.4 Carica papaya evm.TU.supercontig_65.4 I 0.000
F775_32978 Aegilops tauschii F775_32978 I 0.000
gene02234-v1.0-hybrid Fragaria vesca gene02234-v1.0-hybrid I 0.000
gene09733-v1.0-hybrid Fragaria vesca gene09733-v1.0-hybrid I 0.000
gene16050-v1.0-hybrid Fragaria vesca gene16050-v1.0-hybrid N 0.000
gene16844-v1.0-hybrid Fragaria vesca gene16844-v1.0-hybrid I 0.000
gene23280-v1.0-hybrid Fragaria vesca gene23280-v1.0-hybrid I 0.000
GLYMA04G43350 Glycine max GLYMA04G43350 N 0.000
GLYMA10G06080 Glycine max GLYMA10G06080 I 0.000
GLYMA11G20490 Glycine max GLYMA11G20490 I 0.000
GLYMA12G08110 Glycine max GLYMA12G08110 I 0.000
GLYMA12G29720 Glycine max GLYMA12G29720 I 0.000
GLYMA13G02410 Glycine max GLYMA13G02410 N 0.000
GLYMA13G20382 Glycine max GLYMA13G20382 I 0.000
GLYMA13G40030 Glycine max GLYMA13G40030 I 0.000
GLYMA19G36571 Glycine max GLYMA19G36571 I 0.000
Gorai.006G166400 Gossypium raimondii Gorai.006G166400 I 0.000
Gorai.009G107800 Gossypium raimondii Gorai.009G107800 I 0.000
Gorai.009G241900 Gossypium raimondii Gorai.009G241900 I 0.000
Gorai.010G046000 Gossypium raimondii Gorai.010G046000 I 0.000
Gorai.011G238900 Gossypium raimondii Gorai.011G238900 I 0.000
Gorai.012G004800 Gossypium raimondii Gorai.012G004800 I 0.000
Gorai.013G267100 Gossypium raimondii Gorai.013G267100 I 0.000
GRMZM2G153233 Zea mays GRMZM2G153233 I 0.000
GRMZM2G159399 Zea mays GRMZM2G159399 I 0.000
GRMZM2G390641 Zea mays GRMZM2G390641 I 0.000
GSMUA_Achr11G22870_001 Musa acuminata GSMUA_Achr11G22870_001 I 0.000
GSMUA_Achr4G18240_001 Musa acuminata GSMUA_Achr4G18240_001 I 0.000
GSMUA_Achr8G18930_001 Musa acuminata GSMUA_Achr8G18930_001 I 0.000
GSMUA_Achr9G29480_001 Musa acuminata GSMUA_Achr9G29480_001 I 0.000
LPERR02G20290 Leersia perrieri LPERR02G20290 I 0.000
LPERR04G26090 Leersia perrieri LPERR04G26090 N 0.000
LPERR06G21020 Leersia perrieri LPERR06G21020 I 0.000
LPERR10G09970 Leersia perrieri LPERR10G09970 I 0.000
Lus10009770.g Linum usitatissimum Lus10009770.g N 0.000
Lus10016091.g Linum usitatissimum Lus10016091.g I 0.000
Lus10019940.g Linum usitatissimum Lus10019940.g I 0.000
Lus10021467.g Linum usitatissimum Lus10021467.g I 0.000
Lus10024753.g Linum usitatissimum Lus10024753.g N 0.000
Lus10024754.g Linum usitatissimum Lus10024754.g N 0.000
Lus10026510.g Linum usitatissimum Lus10026510.g I 0.000
MDP0000131481 Malus domestica MDP0000131481 I 0.000
MDP0000221322 Malus domestica MDP0000221322 I 0.000
MDP0000232116 Malus domestica MDP0000232116 N 0.000
mgf000336m Mimulus guttatus mgf000336m I 0.000
mgf005300m Mimulus guttatus mgf005300m I 0.000
mgf016139m Mimulus guttatus mgf016139m I 0.000
mgf024607m Mimulus guttatus mgf024607m I 0.000
MLOC_64795 Hordeum vulgare MLOC_64795 I 0.000
MTR_1g094960 Medicago truncatula MTR_1g094960 I 0.000
MTR_2g094570 Medicago truncatula MTR_2g094570 I 0.000
MTR_3g073420 Medicago truncatula MTR_3g073420 N 0.000
MTR_4g058930 Medicago truncatula MTR_4g058930 I 0.000
OB02G32150 Oryza brachyantha OB02G32150 I 0.000
OB06G32920 Oryza brachyantha OB06G32920 I 0.000
OB10G20590 Oryza brachyantha OB10G20590 I 0.000
OBART04G18910 Oryza barthii OBART04G18910 I 0.000
OBART04G30660 Oryza barthii OBART04G30660 N 0.000
OBART06G25230 Oryza barthii OBART06G25230 I 0.000
OBART10G13410 Oryza barthii OBART10G13410 I 0.000
OGLUM01G18360 Oryza glumaepatula OGLUM01G18360 I 0.000
OGLUM02G25270 Oryza glumaepatula OGLUM02G25270 I 0.000
OGLUM04G30530 Oryza glumaepatula OGLUM04G30530 N 0.000
OGLUM06G26560 Oryza glumaepatula OGLUM06G26560 I 0.000
OGLUM10G13220 Oryza glumaepatula OGLUM10G13220 I 0.000
OLONG_021130 Oryza longistaminata OLONG_021130 I 0.000
OMERI02G24320 Oryza meridionalis OMERI02G24320 I 0.000
OMERI04G15770 Oryza meridionalis OMERI04G15770 I 0.000
OMERI04G25770 Oryza meridionalis OMERI04G25770 N 0.000
OMERI06G25370 Oryza meridionalis OMERI06G25370 I 0.000
OMERI10G10210 Oryza meridionalis OMERI10G10210 I 0.000
ONIVA02G27180 Oryza nivara ONIVA02G27180 I 0.000
ONIVA04G29840 Oryza nivara ONIVA04G29840 N 0.000
ONIVA06G28270 Oryza nivara ONIVA06G28270 I 0.000
ONIVA06G31350 Oryza nivara ONIVA06G31350 I 0.000
ONIVA10G14700 Oryza nivara ONIVA10G14700 I 0.000
OPUNC02G22610 Oryza punctata OPUNC02G22610 I 0.000
OPUNC04G16630 Oryza punctata OPUNC04G16630 I 0.000
OPUNC04G28180 Oryza punctata OPUNC04G28180 N 0.000
OPUNC06G22960 Oryza punctata OPUNC06G22960 I 0.000
OPUNC10G11840 Oryza punctata OPUNC10G11840 I 0.000
orange1.1g005075m.g Citrus sinensis orange1.1g005075m.g I 0.000
orange1.1g005482m.g Citrus sinensis orange1.1g005482m.g I 0.000
orange1.1g008078m.g Citrus sinensis orange1.1g008078m.g I 0.000
ORGLA02G0215100 Oryza glaberrima ORGLA02G0215100 I 0.000
ORGLA04G0160200 Oryza glaberrima ORGLA04G0160200 I 0.000
ORGLA04G0270000 Oryza glaberrima ORGLA04G0270000 N 0.000
ORGLA06G0209500 Oryza glaberrima ORGLA06G0209500 I 0.000
ORGLA10G0115500 Oryza glaberrima ORGLA10G0115500 I 0.000
ORUFI02G26180 Oryza rufipogon ORUFI02G26180 I 0.000
ORUFI06G27120 Oryza rufipogon ORUFI06G27120 I 0.000
ORUFI10G14150 Oryza rufipogon ORUFI10G14150 I 0.000
ARF8 Oryza sativa OS02G0628600 I 0.000
OS04G0519700 Oryza sativa OS04G0519700 I 0.000
ARF13 Oryza sativa OS04G0690600 N 0.000
ARF18 Oryza sativa OS06G0685700 I 0.000
ARF22 Oryza sativa OS10G0479900 I 0.000
Pavir.Da00107 Panicum virgatum Pavir.Da00107 I 0.000
Pavir.J03524 Panicum virgatum Pavir.J03524 I 0.000
Pavir.J26437 Panicum virgatum Pavir.J26437 I 0.000
Pavir.J37640 Panicum virgatum Pavir.J37640 I 0.000
PGSC0003DMG400008081 Solanum tuberosum PGSC0003DMG400008081 I 0.000
PGSC0003DMG400021560 Solanum tuberosum PGSC0003DMG400021560 I 0.000
PGSC0003DMG400027798 Solanum tuberosum PGSC0003DMG400027798 N 0.000
PK17007.1 Cannabis sativa PK17007.1 I 0.000
Pm019126 Prunus mume Pm019126 I 0.000
Pm030120 Prunus mume Pm030120 I 0.000
Pm031275 Prunus mume Pm031275 I 0.000
POPTR_0002s09050 Populus trichocarpa POPTR_0002s09050 I 0.000
POPTR_0004s22130 Populus trichocarpa POPTR_0004s22130 I 0.000
POPTR_0005s16320 Populus trichocarpa POPTR_0005s16320 I 0.000
POPTR_0006s12930 Populus trichocarpa POPTR_0006s12930 I 0.000
POPTR_0016s09150 Populus trichocarpa POPTR_0016s09150 I 0.000
POPTR_0848s00200 Populus trichocarpa POPTR_0848s00200 I 0.000
PRUPE_ppa002195mg Prunus persica PRUPE_ppa002195mg I 0.000
PRUPE_ppa003136mg Prunus persica PRUPE_ppa003136mg I 0.000
SapurV1A.0010s0540 Salix purpurea SapurV1A.0010s0540 I 0.000
SapurV1A.0049s0400 Salix purpurea SapurV1A.0049s0400 I 0.000
SapurV1A.0141s0090 Salix purpurea SapurV1A.0141s0090 I 0.000
SapurV1A.0216s0160 Salix purpurea SapurV1A.0216s0160 I 0.000
SapurV1A.0331s0130 Salix purpurea SapurV1A.0331s0130 I 0.000
SapurV1A.0986s0010 Salix purpurea SapurV1A.0986s0010 I 0.000
Sb01g019130 Sorghum bicolor Sb01g019130 I 0.000
Sb10g027790 Sorghum bicolor Sb10g027790 I 0.000
ARF17 Arabidopsis lyrata scaffold_202748.1 N 0.000
ARF16 Arabidopsis lyrata scaffold_701217.1 I 0.000
SELMODRAFT_443304 Selaginella moellendorffii SELMODRAFT_443304 I 0.000
SELMODRAFT_444549 Selaginella moellendorffii SELMODRAFT_444549 I 0.000
Si005991m.g Setaria italica Si005991m.g I 0.000
Si009541m.g Setaria italica Si009541m.g I 0.000
Si021833m.g Setaria italica Si021833m.g N 0.000
Si034525m.g Setaria italica Si034525m.g I 0.000
Solyc09g007810.2 Solanum lycopersicum Solyc09g007810.2 I 0.000
Solyc10g086130.1 Solanum lycopersicum Solyc10g086130.1 I 0.000
Solyc11g013480.1 Solanum lycopersicum Solyc11g013480.1 N 0.000
Solyc11g069500.1 Solanum lycopersicum Solyc11g069500.1 I 0.000
TCM_022163 Theobroma cacao TCM_022163 I 0.000
TCM_035002 Theobroma cacao TCM_035002 I 0.000
TCM_042067 Theobroma cacao TCM_042067 I 0.000
TCM_043157 Theobroma cacao TCM_043157 I 0.000
Thhalv10018331m.g Eutrema salsugineum Thhalv10018331m.g N 0.000
Thhalv10024601m.g Eutrema salsugineum Thhalv10024601m.g I 0.000
ARF10 Vitis vinifera VIT_06s0004g02750 I 0.000
VIT_08s0040g01810 Vitis vinifera VIT_08s0040g01810 I 0.000
ARF16 Vitis vinifera VIT_13s0019g04380 I 0.000