TF Information

RTG_00107 *(Rhodotorula glutinis)* Sox
Pfam ID	Interpro ID	Gene ID	CIS-BP ID	Sequence source	Animal TF db
PF00505 (HMG_box)	IPR000910	RTG_00107	T332375_2.00	Ensembl (2018-Dec-8)	Link out
Directly determined binding motifs
Name/Motif ID	Species	Forward	Reverse	Type/Study/Study ID	SR Score	DBD Identity
No direct experiments
Motifs from related TFs
Name/Motif ID	Species	Forward	Reverse	Type/Study/Study ID	SR Score	DBD Identity
CRC M07266_2.00	Arabidopsis thaliana	TWATCATW	WATGATWA	Dap-seq OMalley et al.(2016) CRC_col_a	0.500	0.261
CRC M07267_2.00	Arabidopsis thaliana	GGTTAGTGTTTTGGAGTCGAATATGACTTG	CAAGTCATATTCGACTCCAAAACACTAACC	Dap-seq OMalley et al.(2016) CRC_colamp_a	0.500	0.261
YAB5 M02486_2.00	Arabidopsis thaliana	NNNNHRN	NYDNNNN	PBM Weirauch et al.(2014) pTH7575	0.466	0.239
YAB5 M00889_2.00	Arabidopsis thaliana	NATRATTADNNN	NNNHTAATYATN	PBM Franco-Zorrilla et al.(2014) YAB5	0.466	0.239
YAB1 M00890_2.00	Arabidopsis thaliana	AATAATWA	TWATTATT	PBM Franco-Zorrilla et al.(2014) YAB1	0.466	0.239
For this family, TFs with SR scores > 0.415* will likely have a similar motif*