SapurV1A.0217s0100 (Salix purpurea)
Sox

TF Information

Pfam ID Interpro ID Gene ID CIS-BP ID Sequence source
PF00505 (HMG_box) IPR000910 SapurV1A.0217s0100 T334700_2.00 JGI:Phytozome (2018-Apr-12)

Directly determined binding motifs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
No direct experiments

Motifs from related TFs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
YAB1
M00890_2.00
Arabidopsis thaliana
AATAATWA

TWATTATT
PBM
Franco-Zorrilla et al.(2014)
YAB1
0.712 0.955
CRC
M07266_2.00
Arabidopsis thaliana
TWATCATW

WATGATWA
Dap-seq
OMalley et al.(2016)
CRC_col_a
0.689 0.705
CRC
M07267_2.00
Arabidopsis thaliana
GGTTAGTGTTTTGGAGTCGAATATGACTTG

CAAGTCATATTCGACTCCAAAACACTAACC
Dap-seq
OMalley et al.(2016)
CRC_colamp_a
0.689 0.705
YAB5
M02486_2.00
Arabidopsis thaliana
NNNNHRN

NYDNNNN
PBM
Weirauch et al.(2014)
pTH7575
0.678 0.932
YAB5
M00889_2.00
Arabidopsis thaliana
NATRATTADNNN

NNNHTAATYATN
PBM
Franco-Zorrilla et al.(2014)
YAB5
0.678 0.932
INO
M02485_2.00
Arabidopsis thaliana
NHNNNYRNNN

NNNYRNNNDN
PBM
Weirauch et al.(2014)
pTH7516
0.567 0.727
For this family, TFs with SR scores > 0.415 will likely have a similar motif

DNA Binding Domains

Protein ID Domain From To Sequence
SapurV1A.0217s0100.1.p Sox 111 154

Links

Other Sox family TFs
Other Salix purpurea TFs

529 Related TFs

Name Species Gene ID Motif Evidence SR
Score
Action
AGABI2DRAFT_189489 Agaricus bisporus AGABI2DRAFT_189489 N 0.000
CERSUDRAFT_118578 Ceriporiopsis subvermispora CERSUDRAFT_118578 N 0.000
CERSUDRAFT_58152 Ceriporiopsis subvermispora CERSUDRAFT_58152 N 0.000
FIBRA_05932 Fibroporia radiculosa FIBRA_05932 N 0.000
FIBRA_05929 Fibroporia radiculosa FIBRA_05929 N 0.000
FOMPIDRAFT_1116028 Fomitopsis pinicola FOMPIDRAFT_1116028 N 0.000
FOMPIDRAFT_1116252 Fomitopsis pinicola FOMPIDRAFT_1116252 N 0.000
GALMADRAFT_132312 Galerina marginata GALMADRAFT_132312 N 0.000
GLOTRDRAFT_108831 Gloeophyllum trabeum GLOTRDRAFT_108831 N 0.000
M413DRAFT_22216 Hebeloma cylindrosporum M413DRAFT_22216 N 0.000
e_gw1.1.2701.1 Heterobasidion annosum e_gw1.1.2701.1 N 0.000
estExt_fgenesh3_kg.C_10130 Heterobasidion annosum estExt_fgenesh3_kg.C_10130 N 0.000
HETIRDRAFT_42232 Heterobasidion irregulare HETIRDRAFT_42232 N 0.000
HETIRDRAFT_437588 Heterobasidion irregulare HETIRDRAFT_437588 N 0.000
JAAARDRAFT_44071 Jaapia argillacea JAAARDRAFT_44071 N 0.000
LACBIDRAFT_320903 Laccaria bicolor LACBIDRAFT_320903 N 0.000
Moror_7184 Moniliophthora roreri Moror_7184 N 0.000
PAXRUDRAFT_128596 Paxillus rubicundulus PAXRUDRAFT_128596 N 0.000
PAXRUDRAFT_29391 Paxillus rubicundulus PAXRUDRAFT_29391 N 0.000
PHACADRAFT_248112 Phanerochaete carnosa PHACADRAFT_248112 N 0.000
PHACADRAFT_24671 Phanerochaete carnosa PHACADRAFT_24671 N 0.000
fgenesh1_pg.C_scaffold_13000199 Phanerochaete chrysosporium fgenesh1_pg.C_scaffold_13000199 N 0.000
fgenesh1_pg.C_scaffold_13000197 Phanerochaete chrysosporium fgenesh1_pg.C_scaffold_13000197 N 0.000
PHLGIDRAFT_21439 Phlebiopsis gigantea PHLGIDRAFT_21439 N 0.000
PHLGIDRAFT_63255 Phlebiopsis gigantea PHLGIDRAFT_63255 N 0.000
PILCRDRAFT_237018 Piloderma croceum PILCRDRAFT_237018 N 0.000
PIIN_02424 Piriformospora indica PIIN_02424 N 0.000
PISMIDRAFT_634734 Pisolithus microcarpus PISMIDRAFT_634734 N 0.000
PISMIDRAFT_87408 Pisolithus microcarpus PISMIDRAFT_87408 N 0.000
PISMIDRAFT_383922 Pisolithus microcarpus PISMIDRAFT_383922 N 0.000
M404DRAFT_137801 Pisolithus tinctorius M404DRAFT_137801 N 0.000
M404DRAFT_137526 Pisolithus tinctorius M404DRAFT_137526 N 0.000
PLEOSDRAFT_1063138 Pleurotus ostreatus PLEOSDRAFT_1063138 N 0.000
POSPLDRAFT_105591 Postia placenta POSPLDRAFT_105591 N 0.000
V565_018480 Rhizoctonia solani V565_018480 N 0.000
SCLCIDRAFT_1207436 Scleroderma citrinum SCLCIDRAFT_1207436 N 0.000
SERLA73DRAFT_190105 Serpula lacrymans SERLA73DRAFT_190105 N 0.000
SERLA73DRAFT_172348 Serpula lacrymans SERLA73DRAFT_172348 N 0.000
CY34DRAFT_21310 Suillus luteus CY34DRAFT_21310 N 0.000
CY34DRAFT_8831 Suillus luteus CY34DRAFT_8831 N 0.000
BN946_scf185007.g223 Trametes cinnabarina BN946_scf185007.g223 N 0.000
BN946_scf185007.g225 Trametes cinnabarina BN946_scf185007.g225 N 0.000