MDOA001488 (Musca domestica)
Sox

TF Information

Pfam ID Interpro ID Gene ID CIS-BP ID Sequence source
PF00505 (HMG_box) IPR000910 MDOA001488 T335850_2.00 Vectorbase (2015-Oct-22)

Directly determined binding motifs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
No direct experiments

Motifs from related TFs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
YAB5
M02486_2.00
Arabidopsis thaliana
NNNNHRN

NYDNNNN
PBM
Weirauch et al.(2014)
pTH7575
0.427 0.283
YAB5
M00889_2.00
Arabidopsis thaliana
NATRATTADNNN

NNNHTAATYATN
PBM
Franco-Zorrilla et al.(2014)
YAB5
0.427 0.283
YAB1
M00890_2.00
Arabidopsis thaliana
AATAATWA

TWATTATT
PBM
Franco-Zorrilla et al.(2014)
YAB1
0.427 0.283
CRC
M07266_2.00
Arabidopsis thaliana
TWATCATW

WATGATWA
Dap-seq
OMalley et al.(2016)
CRC_col_a
0.420 0.283
CRC
M07267_2.00
Arabidopsis thaliana
GGTTAGTGTTTTGGAGTCGAATATGACTTG

CAAGTCATATTCGACTCCAAAACACTAACC
Dap-seq
OMalley et al.(2016)
CRC_colamp_a
0.420 0.283
For this family, TFs with SR scores > 0.415 will likely have a similar motif

DNA Binding Domains

Protein ID Domain From To Sequence
MDOA001488-PA Sox 163 208

Links

Other Sox family TFs
Other Musca domestica TFs

488 Related TFs

Name Species Gene ID Motif Evidence SR
Score
Action
28200.m000191 Ricinus communis 28200.m000191 I 0.427
29854.m001136 Ricinus communis 29854.m001136 I 0.427
29927.m000626 Ricinus communis 29927.m000626 I 0.427
30174.m008839 Ricinus communis 30174.m008839 I 0.427
30174.m009083 Ricinus communis 30174.m009083 I 0.420
AAEL008417 Aedes aegypti AAEL008417 N 0.517
AALB007196 Anopheles albimanus AALB007196 N 0.556
AARA009694 Anopheles arabiensis AARA009694 N 0.588
AATE006267 Anopheles atroparvus AATE006267 N 0.585
ACAC_0000409101 Angiostrongylus cantonensis ACAC_0000409101 N 0.642
ACEP12759 Atta cephalotes ACEP12759 I 0.644
ACHR002403 Anopheles christyi ACHR002403 N 0.588
ACOC_0001323101 Angiostrongylus costaricensis ACOC_0001323101 N 0.642
ACOM033320 Anopheles coluzzii ACOM033320 N 0.588
ACUA003510 Anopheles culicifacies ACUA003510 N 0.588
ACYPI003297 Acyrthosiphon pisum ACYPI003297 I 0.598
ADAC009894 Anopheles darlingi ADAC009894 N 0.556
ADIR002941 Anopheles dirus ADIR002941 N 0.556
AEPI008570 Anopheles epiroticus AEPI008570 N 0.588
AFAF018499 Anopheles farauti AFAF018499 N 0.556
AFUN011346 Anopheles funestus AFUN011346 N 0.556
AGAP004110 Anopheles gambiae AGAP004110 N 0.588
ALNC14_126360 Albugo laibachii ALNC14_126360 N 0.540
ALUE_0001851001 Ascaris lumbricoides ALUE_0001851001 N 0.635
AMAM021723 Anopheles maculatus AMAM021723 N 0.511
AMEC005071 Anopheles melas AMEC005071 N 0.588
AMEM002948 Anopheles merus AMEM002948 N 0.588
AMIN003838 Anopheles minimus AMIN003838 N 0.556
AMTR_s00004p00165390 Amborella trichopoda AMTR_s00004p00165390 I 0.427
AMTR_s00047p00199030 Amborella trichopoda AMTR_s00047p00199030 I 0.420
AMTR_s00078p00029420 Amborella trichopoda AMTR_s00078p00029420 I 0.427
AMTR_s00085p00032940 Amborella trichopoda AMTR_s00085p00032940 I 0.427
ANCCAN_29654 Ancylostoma caninum ANCCAN_29654 N 0.642
ANCCEY_08672 Ancylostoma ceylanicum ANCCEY_08672 N 0.642
AQUA009805 Anopheles quadriannulatus AQUA009805 N 0.588
Aquca_009_00652 Aquilegia coerulea Aquca_009_00652 I 0.427
Aquca_020_00105 Aquilegia coerulea Aquca_020_00105 I 0.427
ASIS023527 Anopheles sinensis ASIS023527 N 0.617
ASTEI04275 Anopheles stephensi ASTEI04275 N 0.588
ASU_10445 Ascaris suum ASU_10445 N 0.635
YAB2 Arabidopsis thaliana AT1G08465 I 0.427
CRC Arabidopsis thaliana AT1G69180 D 0.420
YAB5 Arabidopsis thaliana AT2G26580 D 0.427
YAB1 Arabidopsis thaliana AT2G45190 D 0.427
YAB3 Arabidopsis thaliana AT4G00180 I 0.427
A_06553 Schistosoma haematobium A_06553 N 0.507
BATDEDRAFT_89306 Batrachochytrium dendrobatidis BATDEDRAFT_89306 N 0.432
BGIBMGA013514 Bombyx mori BGIBMGA013514 N 0.623
BGIOSGA013223 Oryza indica BGIOSGA013223 I 0.427
BGIOSGA014650 Oryza indica BGIOSGA014650 I 0.427
BGIOSGA037817 Oryza indica BGIOSGA037817 I 0.427
Bo3g037630 Brassica oleracea Bo3g037630 I 0.427
Bo3g041840 Brassica oleracea Bo3g041840 I 0.427
Bo4g195410 Brassica oleracea Bo4g195410 I 0.427
Bo5g009010 Brassica oleracea Bo5g009010 I 0.427
Bo6g073320 Brassica oleracea Bo6g073320 I 0.427
Bo6g108630 Brassica oleracea Bo6g108630 I 0.420
Bo8g055830 Brassica oleracea Bo8g055830 I 0.427
Bo8g112450 Brassica oleracea Bo8g112450 I 0.427
Bo9g001130 Brassica oleracea Bo9g001130 I 0.427
Bostr.10273s0455 Boechera stricta Bostr.10273s0455 I 0.420
Bostr.14547s0027 Boechera stricta Bostr.14547s0027 I 0.427
Bostr.22545s0001 Boechera stricta Bostr.22545s0001 I 0.427
Bostr.25219s0098 Boechera stricta Bostr.25219s0098 I 0.427
Bostr.25993s0255 Boechera stricta Bostr.25993s0255 I 0.427
Bra000378 Brassica rapa Bra000378 I 0.427
Bra000538 Brassica rapa Bra000538 I 0.427
Bra003309 Brassica rapa Bra003309 I 0.427
Bra004364 Brassica rapa Bra004364 I 0.420
Bra018624 Brassica rapa Bra018624 I 0.427
Bra030728 Brassica rapa Bra030728 I 0.427
Bra031629 Brassica rapa Bra031629 I 0.427
Bra037320 Brassica rapa Bra037320 I 0.427
Bra040322 Brassica rapa Bra040322 I 0.427
BRADI1G13570 Brachypodium distachyon BRADI1G13570 I 0.427
BRADI1G57070 Brachypodium distachyon BRADI1G57070 I 0.416
BRADI3G30410 Brachypodium distachyon BRADI3G30410 I 0.427
BRADI3G50050 Brachypodium distachyon BRADI3G50050 I 0.427
BRADI4G01300 Brachypodium distachyon BRADI4G01300 I 0.427
BRADI5G16910 Brachypodium distachyon BRADI5G16910 I 0.427
Cagra.0239s0072 Capsella grandiflora Cagra.0239s0072 I 0.427
Cagra.0537s0004 Capsella grandiflora Cagra.0537s0004 I 0.420
Cagra.0605s0067 Capsella grandiflora Cagra.0605s0067 I 0.416
Cagra.11302s0003 Capsella grandiflora Cagra.11302s0003 I 0.427
Cagra.1261s0010 Capsella grandiflora Cagra.1261s0010 I 0.427
Cagra.4395s0036 Capsella grandiflora Cagra.4395s0036 I 0.427
CapteG224864 Capitella teleta CapteG224864 I 0.668
Carubv10001833m.g Capsella rubella Carubv10001833m.g I 0.427
Carubv10010384m.g Capsella rubella Carubv10010384m.g I 0.427
Carubv10012024m.g Capsella rubella Carubv10012024m.g I 0.416
Carubv10021641m.g Capsella rubella Carubv10021641m.g I 0.420
Carubv10024011m.g Capsella rubella Carubv10024011m.g I 0.427
Carubv10024208m.g Capsella rubella Carubv10024208m.g I 0.427
cassava10710.m1 Manihot esculenta cassava10710.m1 I 0.420
cassava13509.valid.m1 Manihot esculenta cassava13509.valid.m1 I 0.427
cassava13510.valid.m1 Manihot esculenta cassava13510.valid.m1 I 0.427
cassava13963.valid.m1 Manihot esculenta cassava13963.valid.m1 I 0.427
cassava17722.valid.m1 Manihot esculenta cassava17722.valid.m1 I 0.427
cassava26804.m1 Manihot esculenta cassava26804.m1 I 0.416
cassava30083.valid.m1 Manihot esculenta cassava30083.valid.m1 I 0.427
cassava33847.m1 Manihot esculenta cassava33847.m1 I 0.427
cassava39022.m1 Manihot esculenta cassava39022.m1 I 0.427
cassava39135.m1 Manihot esculenta cassava39135.m1 I 0.420
cassava40986.m1 Manihot esculenta cassava40986.m1 I 0.427
cassava43469.valid.m1 Manihot esculenta cassava43469.valid.m1 I 0.427
Ca_06681 Cicer arietinum Ca_06681 I 0.427
Ca_07101 Cicer arietinum Ca_07101 I 0.427
Ca_12379 Cicer arietinum Ca_12379 I 0.420
Ca_18533 Cicer arietinum Ca_18533 I 0.420
Ca_25981 Cicer arietinum Ca_25981 I 0.427
CBN09380 Caenorhabditis brenneri CBN09380 N 0.631
Cflo_06133--XP_394373.1_APIME Camponotus floridanus Cflo_06133--XP_394373.1_APIME I 0.650
cgd2_870 Cryptosporidium parvum cgd2_870 N 0.416
CGI_10019404 Crassostrea gigas CGI_10019404 N 0.564
Ciclev10009560m.g Citrus clementina Ciclev10009560m.g I 0.427
Ciclev10021834m.g Citrus clementina Ciclev10021834m.g I 0.427
Ciclev10022170m.g Citrus clementina Ciclev10022170m.g I 0.427
Ciclev10029354m.g Citrus clementina Ciclev10029354m.g I 0.427
CJA05209 Caenorhabditis japonica CJA05209 N 0.631
Cla008752 Citrullus lanatus Cla008752 I 0.427
Cla010397 Citrullus lanatus Cla010397 I 0.420
Cla011745 Citrullus lanatus Cla011745 I 0.427
Cla012424 Citrullus lanatus Cla012424 I 0.427
Cla016962 Citrullus lanatus Cla016962 I 0.427
CLEC000086 Cimex lectularius CLEC000086 N 0.507
CLEC002888 Cimex lectularius CLEC002888 N 0.570
CMT447C Cyanidioschyzon merolae CMT447C I 0.415
CPIJ005084 Culex quinquefasciatus CPIJ005084 N 0.602
CpipJ_CPIJ005084 Culex pipiens CpipJ_CPIJ005084 N 0.602
CRE03905 Caenorhabditis remanei CRE03905 N 0.631
Cucsa.086660 Cucumis sativus Cucsa.086660 I 0.427
Cucsa.132170 Cucumis sativus Cucsa.132170 I 0.427
Cucsa.284430 Cucumis sativus Cucsa.284430 I 0.420
Cucsa.295080 Cucumis sativus Cucsa.295080 I 0.427
Cucsa.302100 Cucumis sativus Cucsa.302100 I 0.427
Cucsa.320600 Cucumis sativus Cucsa.320600 I 0.427
D917_07703 Trichinella nativa D917_07703 N 0.496
D918_07944 Trichuris suis D918_07944 N 0.475
DAPPUDRAFT_303074 Daphnia pulex DAPPUDRAFT_303074 N 0.613
DICVIV_03175 Dictyocaulus viviparus DICVIV_03175 N 0.642
DILT_0001250601 Diphyllobothrium latum DILT_0001250601 N 0.506
ECPE_0001800901 Echinostoma caproni ECPE_0001800901 N 0.442
EFV51436 Trichinella spiralis EFV51436 N 0.496
ENSCING00000023833 Ciona intestinalis ENSCING00000023833 N 0.439
CHD4 Echinops telfairi ENSETEG00000005912 N 0.434
CHD4 Microcebus murinus ENSMICG00000006588 N 0.434
ENSMODG00000024829 Monodelphis domestica ENSMODG00000024829 N 0.434
CHD4 Ochotona princeps ENSOPRG00000003477 N 0.434
ccdc124 Oryzias latipes ENSORLG00000015728 N 0.543
ENSSHAG00000004107 Sarcophilus harrisii ENSSHAG00000004107 N 0.434
estExt_fgenesh1_kg.C_80399 Phytophthora capsici estExt_fgenesh1_kg.C_80399 N 0.597
estExt_fgenesh2_pg.C_1070085 Branchiostoma floridae estExt_fgenesh2_pg.C_1070085 N 0.598
estExt_fgenesh2_pm.C_3240002 Branchiostoma floridae estExt_fgenesh2_pm.C_3240002 N 0.598
ETH_00032160 Eimeria tenella ETH_00032160 N 0.467
Eucgr.B03140 Eucalyptus grandis Eucgr.B03140 I 0.420
Eucgr.C01515 Eucalyptus grandis Eucgr.C01515 I 0.427
Eucgr.D02474 Eucalyptus grandis Eucgr.D02474 I 0.427
Eucgr.E01474 Eucalyptus grandis Eucgr.E01474 I 0.427
Eucgr.J00587 Eucalyptus grandis Eucgr.J00587 I 0.427
evm.TU.contig_30608 Carica papaya evm.TU.contig_30608 I 0.420
evm.TU.supercontig_103.34 Carica papaya evm.TU.supercontig_103.34 I 0.427
evm.TU.supercontig_104.5 Carica papaya evm.TU.supercontig_104.5 I 0.427
evm.TU.supercontig_145.3 Carica papaya evm.TU.supercontig_145.3 I 0.427
evm.TU.supercontig_29.121 Carica papaya evm.TU.supercontig_29.121 I 0.427
evm.TU.supercontig_46.14 Carica papaya evm.TU.supercontig_46.14 I 0.427
F443_19335 Phytophthora parasitica F443_19335 N 0.597
F775_25525 Aegilops tauschii F775_25525 I 0.427
F775_27799 Aegilops tauschii F775_27799 I 0.427
F775_28710 Aegilops tauschii F775_28710 I 0.427
GH18160 Drosophila grimshawi FBgn0125628 I 0.632
GK13574 Drosophila willistoni FBgn0215582 I 0.632
GE25578 Drosophila yakuba FBgn0242642 I 0.632
fgenesh1_pg.C_scaffold_73784000001 Phytophthora capsici fgenesh1_pg.C_scaffold_73784000001 N 0.597
fgenesh1_pm.2_#_13 Coccomyxa subellipsoidea C169 fgenesh1_pm.2_#_13 N 0.453
YAB2 Arabidopsis lyrata fgenesh2_kg.1__861__AT1G08465.1 I 0.427
CRC Arabidopsis lyrata fgenesh2_kg.2__1172__AT1G69180.1 I 0.420
YAB5 Arabidopsis lyrata fgenesh2_kg.4__584__AT2G26580.2 I 0.427
YAB3 Arabidopsis lyrata fgenesh2_kg.6__3684__AT4G00180.1 I 0.427
fgeneshCV_pg.C_scaffold_2000022 Chlorella vulgaris fgeneshCV_pg.C_scaffold_2000022 N 0.453
fgenesh_scip_prom.28083.7036 Phytophthora lateralis fgenesh_scip_prom.28083.7036 N 0.571
fgenesh_scip_prom.46568.2049 Phytophthora kernoviae fgenesh_scip_prom.46568.2049 N 0.597
GB50764 Apis mellifera GB50764 I 0.644
gene03938-v1.0-hybrid Fragaria vesca gene03938-v1.0-hybrid I 0.427
gene04566-v1.0-hybrid Fragaria vesca gene04566-v1.0-hybrid I 0.427
gene31056-v1.0-hybrid Fragaria vesca gene31056-v1.0-hybrid I 0.427
gene32251-v1.0-hybrid Fragaria vesca gene32251-v1.0-hybrid I 0.427
GLYMA01G08030 Glycine max GLYMA01G08030 I 0.420
GLYMA01G33370 Glycine max GLYMA01G33370 I 0.427
GLYMA02G13350 Glycine max GLYMA02G13350 I 0.420
GLYMA03G03500 Glycine max GLYMA03G03500 I 0.427
GLYMA04G10125 Glycine max GLYMA04G10125 I 0.420
GLYMA05G04260 Glycine max GLYMA05G04260 I 0.427
GLYMA06G46560 Glycine max GLYMA06G46560 I 0.427
GLYMA08G39290 Glycine max GLYMA08G39290 I 0.420
GLYMA12G10210 Glycine max GLYMA12G10210 I 0.427
GLYMA12G31670 Glycine max GLYMA12G31670 I 0.427
GLYMA13G22620 Glycine max GLYMA13G22620 I 0.427
GLYMA13G38750 Glycine max GLYMA13G38750 I 0.427
GLYMA17G12200 Glycine max GLYMA17G12200 I 0.427
GLYMA17G14710 Glycine max GLYMA17G14710 I 0.427
GLYMA18G19720 Glycine max GLYMA18G19720 I 0.420
Gorai.001G042700 Gossypium raimondii Gorai.001G042700 I 0.427
Gorai.001G127000 Gossypium raimondii Gorai.001G127000 I 0.427
Gorai.001G174800 Gossypium raimondii Gorai.001G174800 I 0.427
Gorai.002G054200 Gossypium raimondii Gorai.002G054200 I 0.420
Gorai.005G146700 Gossypium raimondii Gorai.005G146700 I 0.420
Gorai.006G117800 Gossypium raimondii Gorai.006G117800 I 0.427
Gorai.008G236500 Gossypium raimondii Gorai.008G236500 I 0.427
Gorai.009G016700 Gossypium raimondii Gorai.009G016700 I 0.427
Gorai.009G367100 Gossypium raimondii Gorai.009G367100 I 0.420
Gorai.010G062900 Gossypium raimondii Gorai.010G062900 I 0.427
GPUH_0000676401 Gongylonema pulchrum GPUH_0000676401 N 0.606
GRMZM2G005353 Zea mays GRMZM2G005353 I 0.427
GRMZM2G054795 Zea mays GRMZM2G054795 I 0.427
GRMZM2G074124 Zea mays GRMZM2G074124 I 0.427
GRMZM2G074543 Zea mays GRMZM2G074543 I 0.427
GRMZM2G085873 Zea mays GRMZM2G085873 I 0.427
GRMZM2G106204 Zea mays GRMZM2G106204 I 0.427
GRMZM2G116646 Zea mays GRMZM2G116646 I 0.427
GRMZM2G141955 Zea mays GRMZM2G141955 I 0.427
GRMZM2G167824 Zea mays GRMZM2G167824 I 0.427
GRMZM2G529859 Zea mays GRMZM2G529859 I 0.427
GSMUA_Achr11G03800_001 Musa acuminata GSMUA_Achr11G03800_001 I 0.427
GSMUA_Achr11G17520_001 Musa acuminata GSMUA_Achr11G17520_001 I 0.427
GSMUA_Achr2G12850_001 Musa acuminata GSMUA_Achr2G12850_001 I 0.427
GSMUA_Achr3G15060_001 Musa acuminata GSMUA_Achr3G15060_001 I 0.416
GSMUA_Achr4G22750_001 Musa acuminata GSMUA_Achr4G22750_001 I 0.427
GSMUA_Achr4G31310_001 Musa acuminata GSMUA_Achr4G31310_001 I 0.427
GSMUA_Achr6G31080_001 Musa acuminata GSMUA_Achr6G31080_001 I 0.427
GSMUA_Achr7G01330_001 Musa acuminata GSMUA_Achr7G01330_001 I 0.427
GSMUA_Achr7G07130_001 Musa acuminata GSMUA_Achr7G07130_001 I 0.427
GSMUA_Achr7G07830_001 Musa acuminata GSMUA_Achr7G07830_001 I 0.427
GSMUA_Achr8G04750_001 Musa acuminata GSMUA_Achr8G04750_001 I 0.416
GSMUA_Achr8G11580_001 Musa acuminata GSMUA_Achr8G11580_001 I 0.427
GSMUA_Achr8G26600_001 Musa acuminata GSMUA_Achr8G26600_001 I 0.416
GSMUA_AchrUn_randomG19410_001 Musa acuminata GSMUA_AchrUn_randomG19410_001 I 0.416
GUITHDRAFT_162866 Guillardia theta GUITHDRAFT_162866 N 0.528
HCOI00594600 Haemonchus contortus HCOI00594600 N 0.671
HelroG66455 Helobdella robusta HelroG66455 N 0.670
HHAL005242-PA Halyomorpha halys HHAL005242-PA I 0.678
HMEL009197 Heliconius melpomene HMEL009197 N 0.623
HPBE_0001252601 Heligmosomoides bakeri HPBE_0001252601 N 0.671
HPLM_0000348901 Haemonchus placei HPLM_0000348901 N 0.671
Hsal_04778--XP_394373.1_APIME Harpegnathos saltator Hsal_04778--XP_394373.1_APIME I 0.644
ISCW011313 Ixodes scapularis ISCW011313 N 0.622
KGM_20190 Danaus plexippus KGM_20190 I 0.668
LCUP006380 Lucilia cuprina LCUP006380 N 0.645
LjSGA_107961.1 Lotus japonicus LjSGA_107961.1 I 0.427
LotgiG126557 Lottia gigantea LotgiG126557 N 0.589
LPERR02G20990 Leersia perrieri LPERR02G20990 I 0.427
LPERR03G22960 Leersia perrieri LPERR03G22960 I 0.427
LPERR04G16190 Leersia perrieri LPERR04G16190 I 0.427
LPERR07G03250 Leersia perrieri LPERR07G03250 I 0.427
LPERR10G11580 Leersia perrieri LPERR10G11580 I 0.427
Lus10010361.g Linum usitatissimum Lus10010361.g I 0.427
Lus10013028.g Linum usitatissimum Lus10013028.g I 0.420
Lus10019407.g Linum usitatissimum Lus10019407.g I 0.427
Lus10024603.g Linum usitatissimum Lus10024603.g I 0.431
Lus10029135.g Linum usitatissimum Lus10029135.g I 0.420
Lus10032240.g Linum usitatissimum Lus10032240.g I 0.431
Lus10036496.g Linum usitatissimum Lus10036496.g I 0.427
Lus10036811.g Linum usitatissimum Lus10036811.g I 0.420
maker-nMf.1.1.scaf18285-snap-gene-0.4 Meloidogyne floridensis maker-nMf.1.1.scaf18285-snap-gene-0.4 N 0.599
maker-pir_contig_430-fgenesh-gene-0.3 Pythium irregulare maker-pir_contig_430-fgenesh-gene-0.3 N 0.625
maker-piw_contig_1911-snap-gene-0.6 Pythium iwayamai maker-piw_contig_1911-snap-gene-0.6 N 0.625
maker-pve_contig_105-snap-gene-0.29 Pythium vexans maker-pve_contig_105-snap-gene-0.29 N 0.553
MCINX012524 Melitaea cinxia MCINX012524 I 0.668
MDP0000124879 Malus domestica MDP0000124879 I 0.420
MDP0000171878 Malus domestica MDP0000171878 I 0.420
MDP0000192940 Malus domestica MDP0000192940 I 0.427
MDP0000252640 Malus domestica MDP0000252640 I 0.427
MDP0000255415 Malus domestica MDP0000255415 I 0.427
MDP0000291729 Malus domestica MDP0000291729 I 0.420
MDP0000298333 Malus domestica MDP0000298333 I 0.427
MDP0000331808 Malus domestica MDP0000331808 I 0.427
MDP0000366291 Malus domestica MDP0000366291 I 0.427
MDP0000500810 Malus domestica MDP0000500810 I 0.427
mgf001016m Mimulus guttatus mgf001016m I 0.420
mgf003166m Mimulus guttatus mgf003166m I 0.427
mgf007067m Mimulus guttatus mgf007067m I 0.420
mgf009982m Mimulus guttatus mgf009982m I 0.427
mgf010765m Mimulus guttatus mgf010765m I 0.427
mgf011463m Mimulus guttatus mgf011463m I 0.427
mgf015806m Mimulus guttatus mgf015806m I 0.427
mgf015972m Mimulus guttatus mgf015972m I 0.427
mgf019496m Mimulus guttatus mgf019496m I 0.461
MhA1_Contig1250.frz3.gene10 Meloidogyne hapla MhA1_Contig1250.frz3.gene10 N 0.599
Minc12734 Meloidogyne incognita Minc12734 N 0.599
ML11467a Mnemiopsis leidyi ML11467a N 0.516
MLOC_60897 Hordeum vulgare MLOC_60897 I 0.427
MLOC_66260 Hordeum vulgare MLOC_66260 I 0.427
MLOC_70653 Hordeum vulgare MLOC_70653 I 0.427
MLOC_70676 Hordeum vulgare MLOC_70676 I 0.427
MTR_2g087740 Medicago truncatula MTR_2g087740 I 0.427
MTR_4g025900 Medicago truncatula MTR_4g025900 I 0.427
MTR_4g050300 Medicago truncatula MTR_4g050300 I 0.427
MTR_4g101660 Medicago truncatula MTR_4g101660 I 0.427
MTR_4g114730 Medicago truncatula MTR_4g114730 I 0.427
NBR_0000605501 Nippostrongylus brasiliensis NBR_0000605501 N 0.642
NCLIV_051130 Neospora caninum NCLIV_051130 N 0.429
NECAME_12352 Necator americanus NECAME_12352 N 0.671
NEMVEDRAFT_v1g201358 Nematostella vectensis NEMVEDRAFT_v1g201358 I 0.638
NV13812 Nasonia vitripennis NV13812 I 0.669
OB02G33040 Oryza brachyantha OB02G33040 I 0.427
OB03G35470 Oryza brachyantha OB03G35470 I 0.427
OB04G27010 Oryza brachyantha OB04G27010 I 0.427
OB07G12810 Oryza brachyantha OB07G12810 I 0.427
OB12G26050 Oryza brachyantha OB12G26050 I 0.427
OBART02G25670 Oryza barthii OBART02G25670 I 0.427
OBART03G27740 Oryza barthii OBART03G27740 I 0.427
OBART04G20010 Oryza barthii OBART04G20010 I 0.427
OBART10G15260 Oryza barthii OBART10G15260 I 0.427
OBART12G19190 Oryza barthii OBART12G19190 I 0.427
Ocbimv22013575m.g Octopus bimaculoides Ocbimv22013575m.g I 0.631
OESDEN_05486 Oesophagostomum dentatum OESDEN_05486 N 0.671
OGLUM02G26190 Oryza glumaepatula OGLUM02G26190 I 0.427
OGLUM03G28370 Oryza glumaepatula OGLUM03G28370 I 0.427
OGLUM04G19890 Oryza glumaepatula OGLUM04G19890 I 0.427
OGLUM10G15140 Oryza glumaepatula OGLUM10G15140 I 0.427
OGLUM12G20870 Oryza glumaepatula OGLUM12G20870 I 0.427
OLONG_018568 Oryza longistaminata OLONG_018568 I 0.427
OLONG_018621 Oryza longistaminata OLONG_018621 I 0.427
OMERI02G25190 Oryza meridionalis OMERI02G25190 I 0.427
OMERI04G17000 Oryza meridionalis OMERI04G17000 I 0.427
OMERI07G02330 Oryza meridionalis OMERI07G02330 I 0.427
OMERI10G11950 Oryza meridionalis OMERI10G11950 I 0.427
OMERI12G13460 Oryza meridionalis OMERI12G13460 I 0.427
ONIVA02G03100 Oryza nivara ONIVA02G03100 I 0.427
ONIVA02G28110 Oryza nivara ONIVA02G28110 I 0.427
ONIVA03G28660 Oryza nivara ONIVA03G28660 I 0.427
ONIVA04G18220 Oryza nivara ONIVA04G18220 I 0.427
ONIVA04G21490 Oryza nivara ONIVA04G21490 I 0.427
OPUNC02G23520 Oryza punctata OPUNC02G23520 I 0.427
OPUNC03G25290 Oryza punctata OPUNC03G25290 I 0.427
OPUNC07G03670 Oryza punctata OPUNC07G03670 I 0.427
OPUNC10G13730 Oryza punctata OPUNC10G13730 I 0.427
OPUNC12G17340 Oryza punctata OPUNC12G17340 I 0.427
orange1.1g027215m.g Citrus sinensis orange1.1g027215m.g I 0.427
orange1.1g028144m.g Citrus sinensis orange1.1g028144m.g I 0.427
orange1.1g028980m.g Citrus sinensis orange1.1g028980m.g I 0.427
orange1.1g029862m.g Citrus sinensis orange1.1g029862m.g I 0.427
ORGLA02G0220100 Oryza glaberrima ORGLA02G0220100 I 0.427
ORGLA04G0171000 Oryza glaberrima ORGLA04G0171000 I 0.427
ORGLA12G0165000 Oryza glaberrima ORGLA12G0165000 I 0.427
ORUFI02G27080 Oryza rufipogon ORUFI02G27080 I 0.427
ORUFI03G28820 Oryza rufipogon ORUFI03G28820 I 0.427
ORUFI04G21570 Oryza rufipogon ORUFI04G21570 I 0.427
ORUFI07G03450 Oryza rufipogon ORUFI07G03450 I 0.427
ORUFI10G16240 Oryza rufipogon ORUFI10G16240 I 0.427
ORUFI12G21410 Oryza rufipogon ORUFI12G21410 I 0.427
YAB4 Oryza sativa OS02G0643200 I 0.427
YAB2 Oryza sativa OS03G0650000 I 0.427
YAB5 Oryza sativa OS04G0536300 I 0.427
YAB1 Oryza sativa OS07G0160100 I 0.427
YAB3 Oryza sativa OS10G0508300 I 0.427
YAB6 Oryza sativa OS12G0621100 I 0.427
Pavir.Aa01223 Panicum virgatum Pavir.Aa01223 I 0.427
Pavir.Ab02534 Panicum virgatum Pavir.Ab02534 I 0.427
Pavir.Ba03779 Panicum virgatum Pavir.Ba03779 I 0.427
Pavir.Ca02862 Panicum virgatum Pavir.Ca02862 I 0.427
Pavir.Cb00070 Panicum virgatum Pavir.Cb00070 I 0.427
Pavir.Ga00891 Panicum virgatum Pavir.Ga00891 I 0.427
Pavir.Gb00743 Panicum virgatum Pavir.Gb00743 I 0.427
Pavir.Ia01130 Panicum virgatum Pavir.Ia01130 I 0.427
Pavir.Ib03707 Panicum virgatum Pavir.Ib03707 I 0.427
Pavir.Ib04136 Panicum virgatum Pavir.Ib04136 I 0.427
PEQ_0000413701 Parascaris equorum PEQ_0000413701 N 0.635
PGSC0003DMG400002883 Solanum tuberosum PGSC0003DMG400002883 I 0.427
PGSC0003DMG400002988 Solanum tuberosum PGSC0003DMG400002988 I 0.427
PGSC0003DMG400004741 Solanum tuberosum PGSC0003DMG400004741 I 0.427
PGSC0003DMG400005936 Solanum tuberosum PGSC0003DMG400005936 I 0.427
PGSC0003DMG400025969 Solanum tuberosum PGSC0003DMG400025969 I 0.427
PGSC0003DMG400028360 Solanum tuberosum PGSC0003DMG400028360 I 0.424
PGSC0003DMG400030904 Solanum tuberosum PGSC0003DMG400030904 I 0.427
PHUM036320 Pediculus humanus PHUM036320 N 0.668
Phyra74523 Phytophthora ramorum Phyra74523 N 0.571
Physo132366 Phytophthora sojae Physo132366 N 0.597
PK06964.1 Cannabis sativa PK06964.1 I 0.427
PK09461.1 Cannabis sativa PK09461.1 I 0.427
PK13838.1 Cannabis sativa PK13838.1 I 0.420
Pm001547 Prunus mume Pm001547 I 0.427
Pm006709 Prunus mume Pm006709 I 0.420
Pm017846 Prunus mume Pm017846 I 0.427
Pm023555 Prunus mume Pm023555 I 0.427
Pm027559 Prunus mume Pm027559 I 0.427
Pm030598 Prunus mume Pm030598 I 0.420
POPTR_0001s00240 Populus trichocarpa POPTR_0001s00240 I 0.427
YAB2 Populus trichocarpa POPTR_0001s22180 I 0.427
POPTR_0002s14600 Populus trichocarpa POPTR_0002s14600 I 0.427
POPTR_0003s11230 Populus trichocarpa POPTR_0003s11230 I 0.427
POPTR_0006s06700 Populus trichocarpa POPTR_0006s06700 I 0.427
POPTR_0008s19330 Populus trichocarpa POPTR_0008s19330 I 0.431
POPTR_0010s05220 Populus trichocarpa POPTR_0010s05220 I 0.420
POPTR_0014s06210 Populus trichocarpa POPTR_0014s06210 I 0.427
POPTR_0016s06760 Populus trichocarpa POPTR_0016s06760 I 0.427
POPTR_0018s12990 Populus trichocarpa POPTR_0018s12990 I 0.427
PRUPE_ppa010905mg Prunus persica PRUPE_ppa010905mg I 0.427
PRUPE_ppa011209mg Prunus persica PRUPE_ppa011209mg I 0.427
PRUPE_ppa011880m2g Prunus persica PRUPE_ppa011880m2g I 0.427
PRUPE_ppa012028mg Prunus persica PRUPE_ppa012028mg I 0.427
PRUPE_ppa014900mg Prunus persica PRUPE_ppa014900mg I 0.420
PRUPE_ppa023883mg Prunus persica PRUPE_ppa023883mg I 0.420
PYU1_G003004 Pythium ultimum PYU1_G003004 N 0.625
RPRC009760 Rhodnius prolixus RPRC009760 N 0.601
SapurV1A.0033s0530 Salix purpurea SapurV1A.0033s0530 I 0.427
SapurV1A.0034s0500 Salix purpurea SapurV1A.0034s0500 I 0.427
SapurV1A.0069s0070 Salix purpurea SapurV1A.0069s0070 I 0.420
SapurV1A.0217s0100 Salix purpurea SapurV1A.0217s0100 I 0.427
SapurV1A.0248s0170 Salix purpurea SapurV1A.0248s0170 I 0.431
SapurV1A.0258s0090 Salix purpurea SapurV1A.0258s0090 I 0.427
SapurV1A.0269s0230 Salix purpurea SapurV1A.0269s0230 I 0.420
SapurV1A.0288s0210 Salix purpurea SapurV1A.0288s0210 I 0.427
SapurV1A.0634s0130 Salix purpurea SapurV1A.0634s0130 I 0.427
SapurV1A.1100s0080 Salix purpurea SapurV1A.1100s0080 I 0.427
SapurV1A.1275s0050 Salix purpurea SapurV1A.1275s0050 I 0.427
SapurV1A.2672s0010 Salix purpurea SapurV1A.2672s0010 I 0.427
SapurV1A.3336s0010 Salix purpurea SapurV1A.3336s0010 I 0.427
Sb01g013270 Sorghum bicolor Sb01g013270 I 0.427
Sb01g017560 Sorghum bicolor Sb01g017560 I 0.427
Sb02g003390 Sorghum bicolor Sb02g003390 I 0.427
Sb04g033590 Sorghum bicolor Sb04g033590 I 0.427
Sb06g023770 Sorghum bicolor Sb06g023770 I 0.427
Sb08g022030 Sorghum bicolor Sb08g022030 I 0.427
SBAD_0000307901 Soboliphyme baturini SBAD_0000307901 N 0.576
AFO Arabidopsis lyrata scaffold_403460.1 I 0.427
Si010859m.g Setaria italica Si010859m.g I 0.427
Si018146m.g Setaria italica Si018146m.g I 0.427
Si023308m.g Setaria italica Si023308m.g I 0.427
Si030811m.g Setaria italica Si030811m.g I 0.427
Si036788m.g Setaria italica Si036788m.g I 0.427
Si037789m.g Setaria italica Si037789m.g I 0.427
SINV12391 Solenopsis invicta SINV12391 I 0.644
Sjc_0011880 Schistosoma japonicum Sjc_0011880 N 0.514
Smp_004360 Schistosoma mansoni Smp_004360 N 0.507
SMRZ_0002114501 Schistosoma margrebowiei SMRZ_0002114501 N 0.507
SMU15012775 Schmidtea mediterranea SMU15012775 N 0.418
Solyc01g091010.2 Solanum lycopersicum Solyc01g091010.2 I 0.427
Solyc05g012050.2 Solanum lycopersicum Solyc05g012050.2 I 0.424
Solyc06g073920.2 Solanum lycopersicum Solyc06g073920.2 I 0.427
Solyc07g008180.2 Solanum lycopersicum Solyc07g008180.2 I 0.427
Solyc08g079100.2 Solanum lycopersicum Solyc08g079100.2 I 0.427
Solyc11g071810.1 Solanum lycopersicum Solyc11g071810.1 I 0.427
Solyc12g009580.1 Solanum lycopersicum Solyc12g009580.1 I 0.427
SPRG_06372 Saprolegnia parasitica SPRG_06372 N 0.625
SPU_001776 Strongylocentrotus purpuratus SPU_001776 N 0.554
TC004658 Tribolium castaneum TC004658 N 0.537
TCLT_0001081001 Thelazia callipaeda TCLT_0001081001 N 0.606
TCM_005549 Theobroma cacao TCM_005549 I 0.427
TCM_011484 Theobroma cacao TCM_011484 I 0.420
TCM_016030 Theobroma cacao TCM_016030 I 0.427
TCM_031868 Theobroma cacao TCM_031868 I 0.420
TCM_038105 Theobroma cacao TCM_038105 I 0.427
TCM_041175 Theobroma cacao TCM_041175 I 0.427
TELCIR_11967 Teladorsagia circumcincta TELCIR_11967 N 0.671
tetur18g00680 Tetranychus urticae tetur18g00680 I 0.667
TGME49_037260 Toxoplasma gondii TGME49_037260 N 0.461
Thhalv10001617m.g Eutrema salsugineum Thhalv10001617m.g I 0.427
Thhalv10008858m.g Eutrema salsugineum Thhalv10008858m.g I 0.427
Thhalv10017320m.g Eutrema salsugineum Thhalv10017320m.g I 0.427
Thhalv10019126m.g Eutrema salsugineum Thhalv10019126m.g I 0.420
Thhalv10028925m.g Eutrema salsugineum Thhalv10028925m.g I 0.427
Traes_1DL_C5AF9D06A Triticum aestivum Traes_1DL_C5AF9D06A I 0.427
Traes_2AL_71DE02042 Triticum aestivum Traes_2AL_71DE02042 I 0.427
Traes_2BL_8BEA9CE1B Triticum aestivum Traes_2BL_8BEA9CE1B I 0.427
Traes_5AL_EB97D69D7 Triticum aestivum Traes_5AL_EB97D69D7 I 0.427
Traes_5AS_31C2540C0 Triticum aestivum Traes_5AS_31C2540C0 I 0.427
Traes_5BL_4DEC298F9 Triticum aestivum Traes_5BL_4DEC298F9 I 0.427
Traes_5BS_A782F7510 Triticum aestivum Traes_5BS_A782F7510 I 0.427
Traes_5DL_0E369E1FC Triticum aestivum Traes_5DL_0E369E1FC I 0.427
Traes_5DS_268147383 Triticum aestivum Traes_5DS_268147383 I 0.427
Traes_6AL_2983D4EB6 Triticum aestivum Traes_6AL_2983D4EB6 I 0.427
Traes_6BL_3F8DB6043 Triticum aestivum Traes_6BL_3F8DB6043 I 0.427
Traes_6DL_59DB06B9F Triticum aestivum Traes_6DL_59DB06B9F I 0.427
TRE_0001918901 Trichobilharzia regenti TRE_0001918901 N 0.526
TRIUR3_18590 Triticum urartu TRIUR3_18590 I 0.427
TRIUR3_27402 Triticum urartu TRIUR3_27402 I 0.427
TRIUR3_27479 Triticum urartu TRIUR3_27479 I 0.427
TRIUR3_29073 Triticum urartu TRIUR3_29073 I 0.427
TTRE_0000309701 Trichuris trichiura TTRE_0000309701 N 0.429
CRC Vitis vinifera VIT_01s0011g00140 I 0.420
INO Vitis vinifera VIT_01s0127g00330 I 0.420
VIT_02s0154g00070 Vitis vinifera VIT_02s0154g00070 I 0.427
YAB2 Vitis vinifera VIT_06s0009g00880 I 0.427
VIT_08s0032g01110 Vitis vinifera VIT_08s0032g01110 I 0.427
YAB5 Vitis vinifera VIT_11s0016g05590 I 0.427
VIT_15s0048g00550 Vitis vinifera VIT_15s0048g00550 I 0.427
Y73E7A.1 Caenorhabditis elegans WBGene00022268 N 0.666
XP_002941963 Xenopus tropicalis XP_002941963 N 0.434