GRMZM2G102218 (Zea mays)
Sox

TF Information

Pfam ID Interpro ID Gene ID CIS-BP ID Sequence source Animal TF db
PF00505 (HMG_box) IPR000910 GRMZM2G102218 T330329_2.00 Ensembl (2018-Dec-8) Link out

Directly determined binding motifs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
No direct experiments

Motifs from related TFs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
CRC
M07266_2.00
Arabidopsis thaliana
TWATCATW

WATGATWA
Dap-seq
OMalley et al.(2016)
CRC_col_a
0.673 0.800
CRC
M07267_2.00
Arabidopsis thaliana
GGTTAGTGTTTTGGAGTCGAATATGACTTG

CAAGTCATATTCGACTCCAAAACACTAACC
Dap-seq
OMalley et al.(2016)
CRC_colamp_a
0.673 0.800
YAB1
M00890_2.00
Arabidopsis thaliana
AATAATWA

TWATTATT
PBM
Franco-Zorrilla et al.(2014)
YAB1
0.657 0.689
YAB5
M02486_2.00
Arabidopsis thaliana
NNNNHRN

NYDNNNN
PBM
Weirauch et al.(2014)
pTH7575
0.627 0.667
YAB5
M00889_2.00
Arabidopsis thaliana
NATRATTADNNN

NNNHTAATYATN
PBM
Franco-Zorrilla et al.(2014)
YAB5
0.627 0.667
INO
M02485_2.00
Arabidopsis thaliana
NHNNNYRNNN

NNNYRNNNDN
PBM
Weirauch et al.(2014)
pTH7516
0.556 0.578
For this family, TFs with SR scores > 0.415 will likely have a similar motif

DNA Binding Domains

Protein ID Domain From To Sequence
GRMZM2G102218_P01 Sox 209 253

Links

Other Sox family TFs
Other Zea mays TFs

501 Related TFs

Name Species Gene ID Motif Evidence SR
Score
Action
29739.m003716 Ricinus communis 29739.m003716 I 0.000
Aquca_076_00039 Aquilegia coerulea Aquca_076_00039 I 0.000
ERF017 Arabidopsis thaliana AT1G19210 D 0.000
ERF018 Arabidopsis thaliana AT1G74930 D 0.000
BGIOSGA022471 Oryza indica BGIOSGA022471 I 0.000
BGIOSGA028781 Oryza indica BGIOSGA028781 I 0.000
Bo6g119120 Brassica oleracea Bo6g119120 I 0.000
Bo8g068370 Brassica oleracea Bo8g068370 I 0.000
Bo8g102870 Brassica oleracea Bo8g102870 I 0.000
Bostr.3288s0141 Boechera stricta Bostr.3288s0141 I 0.000
Bra016518 Brassica rapa Bra016518 I 0.000
Bra031069 Brassica rapa Bra031069 I 0.000
BRADI3G37544 Brachypodium distachyon BRADI3G37544 I 0.000
Cagra.1961s0079 Capsella grandiflora Cagra.1961s0079 I 0.000
Carubv10011394m.g Capsella rubella Carubv10011394m.g I 0.000
cassava10604.m1 Manihot esculenta cassava10604.m1 I 0.000
cassava25057.valid.m1 Manihot esculenta cassava25057.valid.m1 I 0.000
Ca_01683 Cicer arietinum Ca_01683 I 0.000
Ciclev10010348m.g Citrus clementina Ciclev10010348m.g I 0.000
Cla011318 Citrullus lanatus Cla011318 I 0.000
Cucsa.141980 Cucumis sativus Cucsa.141980 I 0.000
Eucgr.C00780 Eucalyptus grandis Eucgr.C00780 I 0.000
Eucgr.C03175 Eucalyptus grandis Eucgr.C03175 I 0.000
evm.TU.supercontig_266.5 Carica papaya evm.TU.supercontig_266.5 I 0.000
fgenesh2_kg.1__2098__AT1G19210.1 Arabidopsis lyrata fgenesh2_kg.1__2098__AT1G19210.1 I 0.000
ORA47 Arabidopsis lyrata fgenesh2_kg.2__1761__AT1G74930.1 I 0.000
gene12919-v1.0-hybrid Fragaria vesca gene12919-v1.0-hybrid I 0.000
GLYMA04G06095 Glycine max GLYMA04G06095 I 0.000
GLYMA06G06101 Glycine max GLYMA06G06101 I 0.000
Gorai.001G019100 Gossypium raimondii Gorai.001G019100 I 0.000
Gorai.004G285900 Gossypium raimondii Gorai.004G285900 I 0.000
Gorai.010G091100 Gossypium raimondii Gorai.010G091100 I 0.000
GRMZM2G097081 Zea mays GRMZM2G097081 I 0.000
GRMZM2G163745 Zea mays GRMZM2G163745 I 0.000
GSMUA_Achr5G05160_001 Musa acuminata GSMUA_Achr5G05160_001 I 0.000
GSMUA_Achr9G14360_001 Musa acuminata GSMUA_Achr9G14360_001 I 0.000
GSMUA_AchrUn_randomG02200_001 Musa acuminata GSMUA_AchrUn_randomG02200_001 I 0.000
LPERR08G14000 Leersia perrieri LPERR08G14000 I 0.000
Lus10009798.g Linum usitatissimum Lus10009798.g I 0.000
Lus10033420.g Linum usitatissimum Lus10033420.g I 0.000
Lus10034885.g Linum usitatissimum Lus10034885.g I 0.000
Lus10038082.g Linum usitatissimum Lus10038082.g I 0.000
MDP0000649022 Malus domestica MDP0000649022 I 0.000
mgf024162m Mimulus guttatus mgf024162m I 0.000
MTR_3g105480 Medicago truncatula MTR_3g105480 I 0.000
MTR_3g105510 Medicago truncatula MTR_3g105510 I 0.000
OB08G24280 Oryza brachyantha OB08G24280 I 0.000
OBART06G06190 Oryza barthii OBART06G06190 I 0.000
OBART08G16950 Oryza barthii OBART08G16950 I 0.000
OGLUM06G06520 Oryza glumaepatula OGLUM06G06520 I 0.000
OGLUM08G17690 Oryza glumaepatula OGLUM08G17690 I 0.000
OMERI03G32210 Oryza meridionalis OMERI03G32210 I 0.000
ONIVA06G07190 Oryza nivara ONIVA06G07190 I 0.000
ONIVA08G18470 Oryza nivara ONIVA08G18470 I 0.000
OPUNC08G14840 Oryza punctata OPUNC08G14840 I 0.000
ORGLA06G0057200 Oryza glaberrima ORGLA06G0057200 I 0.000
ORUFI06G06480 Oryza rufipogon ORUFI06G06480 I 0.000
ORUFI08G18850 Oryza rufipogon ORUFI08G18850 I 0.000
OS08G0454000 Oryza sativa OS08G0454000 I 0.000
Pavir.Aa00296 Panicum virgatum Pavir.Aa00296 I 0.000
Pavir.Fa00741 Panicum virgatum Pavir.Fa00741 I 0.000
Pavir.Fb01602 Panicum virgatum Pavir.Fb01602 I 0.000
Pavir.J00593 Panicum virgatum Pavir.J00593 I 0.000
PGSC0003DMG400030781 Solanum tuberosum PGSC0003DMG400030781 I 0.000
Pm027117 Prunus mume Pm027117 I 0.000
POPTR_0006s14090 Populus trichocarpa POPTR_0006s14090 I 0.000
POPTR_0006s14100 Populus trichocarpa POPTR_0006s14100 I 0.000
POPTR_0006s23480 Populus trichocarpa POPTR_0006s23480 I 0.000
PRUPE_ppa011336mg Prunus persica PRUPE_ppa011336mg I 0.000
SapurV1A.0057s0300 Salix purpurea SapurV1A.0057s0300 I 0.000
SapurV1A.0373s0040 Salix purpurea SapurV1A.0373s0040 I 0.000
SapurV1A.0521s0050 Salix purpurea SapurV1A.0521s0050 I 0.000
SapurV1A.2229s0010 Salix purpurea SapurV1A.2229s0010 I 0.000
Sb07g022265 Sorghum bicolor Sb07g022265 I 0.000
Si008104m.g Setaria italica Si008104m.g I 0.000
Si015027m.g Setaria italica Si015027m.g I 0.000
Si019636m.g Setaria italica Si019636m.g I 0.000
Solyc06g054630.1 Solanum lycopersicum Solyc06g054630.1 I 0.000
TCM_037415 Theobroma cacao TCM_037415 I 0.000
TCM_037486 Theobroma cacao TCM_037486 I 0.000
Thhalv10009812m.g Eutrema salsugineum Thhalv10009812m.g I 0.000
TRAES3BF084200010CFD_g Triticum aestivum TRAES3BF084200010CFD_g I 0.000
Traes_6DL_FA861D610 Triticum aestivum Traes_6DL_FA861D610 I 0.000
ORA47 Vitis vinifera VIT_04s0008g02230 I 0.000
VIT_11s0016g00660 Vitis vinifera VIT_11s0016g00660 I 0.000