MDP0000209974 (Malus domestica)
Myb/SANT

TF Information

Pfam ID Interpro ID Gene ID CIS-BP ID Sequence source
PF00249 (Myb_DNA-binding) IPR014778 MDP0000209974 T288422_2.00 JGI:Phytozome (2018-Apr-12)

Directly determined binding motifs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
No direct experiments

Motifs from related TFs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
PK21687.1
M01282_2.00
Cannabis sativa
HWAAACCYH

DRGGTTTWD
PBM
Lambert et al.(2019)
pTH11299
0.909 1.000
TRP2
M07092_2.00
Arabidopsis thaliana
AAACCCTAAACCCTAAACCC

GGGTTTAGGGTTTAGGGTTT
Dap-seq
OMalley et al.(2016)
TRP2_col_a
0.901 0.979
TRP2
M07093_2.00
Arabidopsis thaliana
AAACCCTAAACCCTAAACCCT

AGGGTTTAGGGTTTAGGGTTT
Dap-seq
OMalley et al.(2016)
TRP2_colamp_a
0.901 0.979
TRP1
M07148_2.00
Arabidopsis thaliana
AAACCCTAAACCCTAAACCCTAA

TTAGGGTTTAGGGTTTAGGGTTT
Dap-seq
OMalley et al.(2016)
TRP1_col
0.891 0.957
TRP5
M01266_2.00
Arabidopsis thaliana
NHWAAACCYH

DRGGTTTWDN
PBM
Lambert et al.(2019)
pTH9963
0.849 0.957
For this family, TFs with SR scores > 0.661 will likely have a similar motif

DNA Binding Domains

Protein ID Domain From To Sequence
MDP0000209974 Myb 582 632

Links

Other Myb/SANT family TFs
Other Malus domestica TFs

197 Related TFs

Name Species Gene ID Motif Evidence SR
Score
Action
ENSAMEG00000002010 Ailuropoda melanoleuca ENSAMEG00000002010 I 0.000
Alligator_sinensis_CCG004454.1 Alligator sinensis Alligator_sinensis_CCG004454.1 I 0.000
ENSAMXG00000011871 Astyanax mexicanus ENSAMXG00000011871 I 0.000
ENSBTAP00000012119-D1 Bos grunniens ENSBTAP00000012119-D1 I 0.000
GLIS2 Bos taurus ENSBTAG00000009199 I 0.000
GLIS2 Callithrix jacchus ENSCJAG00000019770 I 0.000
GLIS2 Canis familiaris ENSCAFG00000019227 I 0.000
ENSCPOG00000004787 Cavia porcellus ENSCPOG00000004787 I 0.000
Cmyd_10017688 Chelonia mydas Cmyd_10017688 I 0.000
ENSCSAG00000009593 Chlorocebus sabaeus ENSCSAG00000009593 I 0.000
GLIS2 Dasypus novemcinctus ENSDNOG00000010899 I 0.000
ENSDORG00000014886 Dipodomys ordii ENSDORG00000014886 I 0.000
GLIS2 Echinops telfairi ENSETEG00000006418 I 0.000
GLIS2 Equus caballus ENSECAG00000020639 I 0.000
GLIS2 Erinaceus europaeus ENSEEUG00000007346 I 0.000
GLIS2 Felis catus ENSFCAG00000011229 I 0.000
GLIS2 Gorilla gorilla ENSGGOG00000004717 I 0.000
GLIS2 Homo sapiens ENSG00000126603 D 0.000
ENSSTOG00000025049 Ictidomys tridecemlineatus ENSSTOG00000025049 I 0.000
ENSLACG00000004164 Latimeria chalumnae ENSLACG00000004164 I 0.000
GLIS2 Loxodonta africana ENSLAFG00000018480 I 0.000
GLIS2 Microcebus murinus ENSMICG00000017817 I 0.000
GLIS2 Monodelphis domestica ENSMODG00000016375 I 0.000
ENSMPUG00000015020 Mustela putorius furo ENSMPUG00000015020 I 0.000
Glis2 Mus musculus ENSMUSG00000014303 D 0.000
Myotis_brandtii_GLIS2_10028036 Myotis brandtii Myotis_brandtii_GLIS2_10028036 I 0.000
GLIS2 Myotis lucifugus ENSMLUG00000008930 I 0.000
ENSNLEG00000009834 Nomascus leucogenys ENSNLEG00000009834 I 0.000
GLIS2 Ochotona princeps ENSOPRG00000000484 I 0.000
GLIS2 Ornithorhynchus anatinus ENSOANG00000010385 I 0.000
GLIS2 Oryctolagus cuniculus ENSOCUG00000012971 I 0.000
GLIS2 Otolemur garnettii ENSOGAG00000015200 I 0.000
ENSOARG00000003260 Ovis aries ENSOARG00000003260 I 0.000
GLIS2 Pan troglodytes ENSPTRG00000007714 I 0.000
Pvit_18995 Pogona vitticeps Pvit_18995 I 0.000
ENSPPYG00000007055 Pongo abelii ENSPPYG00000007055 I 0.000
GLIS2 Procavia capensis ENSPCAG00000011063 I 0.000
GLIS2 Pteropus vampyrus ENSPVAG00000017802 I 0.000
Glis2 Rattus norvegicus ENSRNOG00000004766 I 0.000
ENSSHAG00000010956 Sarcophilus harrisii ENSSHAG00000010956 I 0.000
SINV25327 Solenopsis invicta SINV25327 I 0.000
SPU_010542 Strongylocentrotus purpuratus SPU_010542 I 0.000
GLIS2 Sus scrofa ENSSSCG00000023653 I 0.000
GLIS2 Tursiops truncatus ENSTTRG00000002711 I 0.000
glis2.L Xenopus laevis XB-GENE-6252690 I 0.000