GLYMA01G03580 (Glycine max)
Sox

TF Information

Pfam ID Interpro ID Gene ID CIS-BP ID Sequence source Animal TF db
PF00505 (HMG_box) IPR000910 GLYMA01G03580 T330254_2.00 Ensembl (2018-Dec-8) Link out

Directly determined binding motifs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
No direct experiments

Motifs from related TFs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
INO
M02485_2.00
Arabidopsis thaliana
NHNNNYRNNN

NNNYRNNNDN
PBM
Weirauch et al.(2014)
pTH7516
0.615 0.800
YAB5
M02486_2.00
Arabidopsis thaliana
NNNNHRN

NYDNNNN
PBM
Weirauch et al.(2014)
pTH7575
0.594 0.816
YAB5
M00889_2.00
Arabidopsis thaliana
NATRATTADNNN

NNNHTAATYATN
PBM
Franco-Zorrilla et al.(2014)
YAB5
0.594 0.816
YAB1
M00890_2.00
Arabidopsis thaliana
AATAATWA

TWATTATT
PBM
Franco-Zorrilla et al.(2014)
YAB1
0.594 0.789
CRC
M07266_2.00
Arabidopsis thaliana
TWATCATW

WATGATWA
Dap-seq
OMalley et al.(2016)
CRC_col_a
0.565 0.632
CRC
M07267_2.00
Arabidopsis thaliana
GGTTAGTGTTTTGGAGTCGAATATGACTTG

CAAGTCATATTCGACTCCAAAACACTAACC
Dap-seq
OMalley et al.(2016)
CRC_colamp_a
0.523 0.450
For this family, TFs with SR scores > 0.415 will likely have a similar motif

DNA Binding Domains

Protein ID Domain From To Sequence
GLYMA01G03580.2 Sox 166 225
GLYMA01G03580.3 Sox 166 205
GLYMA01G03580.4 Sox 166 203

Links

Other Sox family TFs
Other Glycine max TFs

481 Related TFs

Name Species Gene ID Motif Evidence SR
Score
Action
GLYMA04G10125 Glycine max GLYMA04G10125 I 0.702
Ciclev10033714m.g Citrus clementina Ciclev10033714m.g I 0.689
Lus10013028.g Linum usitatissimum Lus10013028.g I 0.669
Lus10029135.g Linum usitatissimum Lus10029135.g I 0.669
SapurV1A.0269s0230 Salix purpurea SapurV1A.0269s0230 I 0.663
POPTR_0010s05220 Populus trichocarpa POPTR_0010s05220 I 0.663
SapurV1A.0069s0070 Salix purpurea SapurV1A.0069s0070 I 0.663
Carubv10012024m.g Capsella rubella Carubv10012024m.g I 0.659
Cagra.0605s0067 Capsella grandiflora Cagra.0605s0067 I 0.659
Lus10030892.g Linum usitatissimum Lus10030892.g I 0.658
MLOC_66260 Hordeum vulgare MLOC_66260 I 0.650
GLYMA12G31670 Glycine max GLYMA12G31670 I 0.650
Eucgr.J00587 Eucalyptus grandis Eucgr.J00587 I 0.650
Cla005767 Citrullus lanatus Cla005767 I 0.650
orange1.1g046045m.g Citrus sinensis orange1.1g046045m.g I 0.649
chr2.CM0008.270.nc Lotus japonicus chr2.CM0008.270.nc I 0.649
TCM_041175 Theobroma cacao TCM_041175 I 0.647
GLYMA08G39290 Glycine max GLYMA08G39290 I 0.646
GLYMA18G19720 Glycine max GLYMA18G19720 I 0.646
MTR_5g034030 Medicago truncatula MTR_5g034030 I 0.644
SapurV1A.0248s0170 Salix purpurea SapurV1A.0248s0170 I 0.626
Bra012373 Brassica rapa Bra012373 I 0.624
Bostr.12659s0203 Boechera stricta Bostr.12659s0203 I 0.624
Bo7g056180 Brassica oleracea Bo7g056180 I 0.624
Bo5g039580 Brassica oleracea Bo5g039580 I 0.624
Bra024599 Brassica rapa Bra024599 I 0.624
INO Arabidopsis lyrata fgenesh1_pg.C_scaffold_1002152 I 0.624
INO Arabidopsis thaliana AT1G23420 D 0.624
Thhalv10008669m.g Eutrema salsugineum Thhalv10008669m.g I 0.624
POPTR_0008s19330 Populus trichocarpa POPTR_0008s19330 I 0.623
Traes_3AL_730255B9F Triticum aestivum Traes_3AL_730255B9F I 0.621
chr2.CM0237.250.nd Lotus japonicus chr2.CM0237.250.nd I 0.618
Ca_21472 Cicer arietinum Ca_21472 I 0.615
GLYMA06G10110 Glycine max GLYMA06G10110 I 0.606
cassava27370.m1 Manihot esculenta cassava27370.m1 I 0.605
BRADI1G57070 Brachypodium distachyon BRADI1G57070 I 0.605
GSMUA_AchrUn_randomG19410_001 Musa acuminata GSMUA_AchrUn_randomG19410_001 I 0.605
mgf007067m Mimulus guttatus mgf007067m I 0.600
SapurV1A.0258s0090 Salix purpurea SapurV1A.0258s0090 I 0.600
POPTR_0016s06760 Populus trichocarpa POPTR_0016s06760 I 0.600
AMTR_s00047p00199030 Amborella trichopoda AMTR_s00047p00199030 I 0.600
Lus10024603.g Linum usitatissimum Lus10024603.g I 0.599
PRUPE_ppa023883mg Prunus persica PRUPE_ppa023883mg I 0.599
INO Vitis vinifera VIT_01s0127g00330 I 0.599
GSMUA_Achr3G30800_001 Musa acuminata GSMUA_Achr3G30800_001 I 0.599
Lus10032240.g Linum usitatissimum Lus10032240.g I 0.599
Pm006709 Prunus mume Pm006709 I 0.599
Solyc05g012050.2 Solanum lycopersicum Solyc05g012050.2 I 0.598
Cla000824 Citrullus lanatus Cla000824 I 0.598
PGSC0003DMG400028360 Solanum tuberosum PGSC0003DMG400028360 I 0.598
orange1.1g037247m.g Citrus sinensis orange1.1g037247m.g I 0.598
Cucsa.394330 Cucumis sativus Cucsa.394330 I 0.598
cassava41595.m1 Manihot esculenta cassava41595.m1 I 0.598
cassava26804.m1 Manihot esculenta cassava26804.m1 I 0.595
YAB6 Oryza sativa OS12G0621100 I 0.594
PGSC0003DMG400002883 Solanum tuberosum PGSC0003DMG400002883 I 0.594
Bostr.14547s0027 Boechera stricta Bostr.14547s0027 I 0.594
PGSC0003DMG400002988 Solanum tuberosum PGSC0003DMG400002988 I 0.594
Bostr.25993s0255 Boechera stricta Bostr.25993s0255 I 0.594
Bostr.25219s0098 Boechera stricta Bostr.25219s0098 I 0.594
Bostr.22545s0001 Boechera stricta Bostr.22545s0001 I 0.594
POPTR_0006s06700 Populus trichocarpa POPTR_0006s06700 I 0.594
YAB2 Populus trichocarpa POPTR_0001s22180 I 0.594
Cagra.0239s0072 Capsella grandiflora Cagra.0239s0072 I 0.594
PGSC0003DMG400005936 Solanum tuberosum PGSC0003DMG400005936 I 0.594
Cagra.11302s0003 Capsella grandiflora Cagra.11302s0003 I 0.594
PGSC0003DMG400030904 Solanum tuberosum PGSC0003DMG400030904 I 0.594
PGSC0003DMG400004741 Solanum tuberosum PGSC0003DMG400004741 I 0.594
ORUFI07G03450 Oryza rufipogon ORUFI07G03450 I 0.594
ONIVA02G03100 Oryza nivara ONIVA02G03100 I 0.594
OMERI12G13460 Oryza meridionalis OMERI12G13460 I 0.594
Eucgr.D02474 Eucalyptus grandis Eucgr.D02474 I 0.594
ONIVA03G28660 Oryza nivara ONIVA03G28660 I 0.594
Eucgr.B03140 Eucalyptus grandis Eucgr.B03140 I 0.594
Eucgr.C01515 Eucalyptus grandis Eucgr.C01515 I 0.594
evm.TU.contig_30608 Carica papaya evm.TU.contig_30608 I 0.594
OMERI07G02330 Oryza meridionalis OMERI07G02330 I 0.594
evm.TU.supercontig_46.14 Carica papaya evm.TU.supercontig_46.14 I 0.594
OGLUM12G20870 Oryza glumaepatula OGLUM12G20870 I 0.594
OLONG_018568 Oryza longistaminata OLONG_018568 I 0.594
evm.TU.supercontig_104.5 Carica papaya evm.TU.supercontig_104.5 I 0.594
evm.TU.supercontig_103.34 Carica papaya evm.TU.supercontig_103.34 I 0.594
OPUNC03G25290 Oryza punctata OPUNC03G25290 I 0.594
OPUNC07G03670 Oryza punctata OPUNC07G03670 I 0.594
ORUFI12G21410 Oryza rufipogon ORUFI12G21410 I 0.594
Carubv10010384m.g Capsella rubella Carubv10010384m.g I 0.594
Carubv10001833m.g Capsella rubella Carubv10001833m.g I 0.594
Cagra.4395s0036 Capsella grandiflora Cagra.4395s0036 I 0.594
Cagra.1261s0010 Capsella grandiflora Cagra.1261s0010 I 0.594
YAB2 Oryza sativa OS03G0650000 I 0.594
ORUFI03G28820 Oryza rufipogon ORUFI03G28820 I 0.594
Carubv10024011m.g Capsella rubella Carubv10024011m.g I 0.594
OPUNC12G17340 Oryza punctata OPUNC12G17340 I 0.594
Ciclev10029354m.g Citrus clementina Ciclev10029354m.g I 0.594
Ciclev10009560m.g Citrus clementina Ciclev10009560m.g I 0.594
Carubv10024208m.g Capsella rubella Carubv10024208m.g I 0.594
ORGLA12G0165000 Oryza glaberrima ORGLA12G0165000 I 0.594
YAB1 Oryza sativa OS07G0160100 I 0.594
Si030811m.g Setaria italica Si030811m.g I 0.594
cassava33847.m1 Manihot esculenta cassava33847.m1 I 0.594
cassava39022.m1 Manihot esculenta cassava39022.m1 I 0.594
CRC Vitis vinifera VIT_01s0011g00140 I 0.594
YAB2 Vitis vinifera VIT_06s0009g00880 I 0.594
Ca_06681 Cicer arietinum Ca_06681 I 0.594
YAB5 Vitis vinifera VIT_11s0016g05590 I 0.594
TRIUR3_27402 Triticum urartu TRIUR3_27402 I 0.594
TRIUR3_18590 Triticum urartu TRIUR3_18590 I 0.594
Traes_5BS_A782F7510 Triticum aestivum Traes_5BS_A782F7510 I 0.594
Traes_5BL_4DEC298F9 Triticum aestivum Traes_5BL_4DEC298F9 I 0.594
Traes_5DL_0E369E1FC Triticum aestivum Traes_5DL_0E369E1FC I 0.594
Traes_5DS_268147383 Triticum aestivum Traes_5DS_268147383 I 0.594
cassava39135.m1 Manihot esculenta cassava39135.m1 I 0.594
cassava40986.m1 Manihot esculenta cassava40986.m1 I 0.594
Ca_07101 Cicer arietinum Ca_07101 I 0.594
Ca_12379 Cicer arietinum Ca_12379 I 0.594
cassava10710.m1 Manihot esculenta cassava10710.m1 I 0.594
Pm001547 Prunus mume Pm001547 I 0.594
30174.m009083 Ricinus communis 30174.m009083 I 0.594
Pm027559 Prunus mume Pm027559 I 0.594
29927.m000626 Ricinus communis 29927.m000626 I 0.594
Pm030598 Prunus mume Pm030598 I 0.594
Cla016962 Citrullus lanatus Cla016962 I 0.594
Cla012424 Citrullus lanatus Cla012424 I 0.594
Cla008752 Citrullus lanatus Cla008752 I 0.594
Ca_18533 Cicer arietinum Ca_18533 I 0.594
cassava13510.valid.m1 Manihot esculenta cassava13510.valid.m1 I 0.594
Cla010397 Citrullus lanatus Cla010397 I 0.594
cassava13509.valid.m1 Manihot esculenta cassava13509.valid.m1 I 0.594
Traes_5AS_31C2540C0 Triticum aestivum Traes_5AS_31C2540C0 I 0.594
Traes_5AL_EB97D69D7 Triticum aestivum Traes_5AL_EB97D69D7 I 0.594
mgf015972m Mimulus guttatus mgf015972m I 0.594
Sb02g003390 Sorghum bicolor Sb02g003390 I 0.594
Sb08g022030 Sorghum bicolor Sb08g022030 I 0.594
AFO Arabidopsis lyrata scaffold_403460.1 I 0.594
Si023308m.g Setaria italica Si023308m.g I 0.594
mgf010765m Mimulus guttatus mgf010765m I 0.594
mgf019496m Mimulus guttatus mgf019496m I 0.594
Aquca_009_00652 Aquilegia coerulea Aquca_009_00652 I 0.594
PRUPE_ppa011880m2g Prunus persica PRUPE_ppa011880m2g I 0.594
Aquca_020_00105 Aquilegia coerulea Aquca_020_00105 I 0.594
PRUPE_ppa012028mg Prunus persica PRUPE_ppa012028mg I 0.594
PRUPE_ppa014900mg Prunus persica PRUPE_ppa014900mg I 0.594
Sb01g013270 Sorghum bicolor Sb01g013270 I 0.594
gene03938-v1.0-hybrid Fragaria vesca gene03938-v1.0-hybrid I 0.594
mgf009982m Mimulus guttatus mgf009982m I 0.594
TCM_038105 Theobroma cacao TCM_038105 I 0.594
TCM_011484 Theobroma cacao TCM_011484 I 0.594
Cucsa.295080 Cucumis sativus Cucsa.295080 I 0.594
Cucsa.284430 Cucumis sativus Cucsa.284430 I 0.594
Cucsa.086660 Cucumis sativus Cucsa.086660 I 0.594
Cucsa.132170 Cucumis sativus Cucsa.132170 I 0.594
Solyc12g009580.1 Solanum lycopersicum Solyc12g009580.1 I 0.594
Solyc11g071810.1 Solanum lycopersicum Solyc11g071810.1 I 0.594
mgf001016m Mimulus guttatus mgf001016m I 0.594
Si037789m.g Setaria italica Si037789m.g I 0.594
Solyc06g073920.2 Solanum lycopersicum Solyc06g073920.2 I 0.594
Solyc07g008180.2 Solanum lycopersicum Solyc07g008180.2 I 0.594
Solyc08g079100.2 Solanum lycopersicum Solyc08g079100.2 I 0.594
POPTR_0018s12990 Populus trichocarpa POPTR_0018s12990 I 0.594
OBART12G19190 Oryza barthii OBART12G19190 I 0.594
YAB3 Arabidopsis lyrata fgenesh2_kg.6__3684__AT4G00180.1 I 0.594
YAB5 Arabidopsis lyrata fgenesh2_kg.4__584__AT2G26580.2 I 0.594
SapurV1A.0034s0500 Salix purpurea SapurV1A.0034s0500 I 0.594
GLYMA01G08030 Glycine max GLYMA01G08030 I 0.594
Pavir.Ib04136 Panicum virgatum Pavir.Ib04136 I 0.594
GLYMA02G13350 Glycine max GLYMA02G13350 I 0.594
YAB2 Arabidopsis lyrata fgenesh2_kg.1__861__AT1G08465.1 I 0.594
F775_28710 Aegilops tauschii F775_28710 I 0.594
Thhalv10001617m.g Eutrema salsugineum Thhalv10001617m.g I 0.594
BRADI1G13570 Brachypodium distachyon BRADI1G13570 I 0.594
SapurV1A.3336s0010 Salix purpurea SapurV1A.3336s0010 I 0.594
BRADI4G01300 Brachypodium distachyon BRADI4G01300 I 0.594
SapurV1A.0288s0210 Salix purpurea SapurV1A.0288s0210 I 0.594
SapurV1A.1100s0080 Salix purpurea SapurV1A.1100s0080 I 0.594
Pavir.Ia01130 Panicum virgatum Pavir.Ia01130 I 0.594
GLYMA06G46560 Glycine max GLYMA06G46560 I 0.594
GRMZM2G085873 Zea mays GRMZM2G085873 I 0.594
Pavir.Ba03779 Panicum virgatum Pavir.Ba03779 I 0.594
GRMZM2G106204 Zea mays GRMZM2G106204 I 0.594
GRMZM2G116646 Zea mays GRMZM2G116646 I 0.594
orange1.1g029862m.g Citrus sinensis orange1.1g029862m.g I 0.594
GRMZM2G141955 Zea mays GRMZM2G141955 I 0.594
GRMZM2G074124 Zea mays GRMZM2G074124 I 0.594
gene04566-v1.0-hybrid Fragaria vesca gene04566-v1.0-hybrid I 0.594
GLYMA13G22620 Glycine max GLYMA13G22620 I 0.594
GLYMA12G10210 Glycine max GLYMA12G10210 I 0.594
GLYMA13G38750 Glycine max GLYMA13G38750 I 0.594
GLYMA17G12200 Glycine max GLYMA17G12200 I 0.594
Pavir.Cb00070 Panicum virgatum Pavir.Cb00070 I 0.594
Bra040322 Brassica rapa Bra040322 I 0.594
Bra037320 Brassica rapa Bra037320 I 0.594
PK06964.1 Cannabis sativa PK06964.1 I 0.594
PK09461.1 Cannabis sativa PK09461.1 I 0.594
BGIOSGA013223 Oryza indica BGIOSGA013223 I 0.594
Thhalv10028925m.g Eutrema salsugineum Thhalv10028925m.g I 0.594
Bo3g037630 Brassica oleracea Bo3g037630 I 0.594
BGIOSGA037817 Oryza indica BGIOSGA037817 I 0.594
YAB3 Arabidopsis thaliana AT4G00180 I 0.594
YAB1 Arabidopsis thaliana AT2G45190 D 0.594
AMTR_s00078p00029420 Amborella trichopoda AMTR_s00078p00029420 I 0.594
AMTR_s00004p00165390 Amborella trichopoda AMTR_s00004p00165390 I 0.594
AMTR_s00085p00032940 Amborella trichopoda AMTR_s00085p00032940 I 0.594
YAB2 Arabidopsis thaliana AT1G08465 I 0.594
YAB5 Arabidopsis thaliana AT2G26580 D 0.594
PK13838.1 Cannabis sativa PK13838.1 I 0.594
Bo3g041840 Brassica oleracea Bo3g041840 I 0.594
Bo4g195410 Brassica oleracea Bo4g195410 I 0.594
Bra003309 Brassica rapa Bra003309 I 0.594
Bra000538 Brassica rapa Bra000538 I 0.594
Thhalv10008858m.g Eutrema salsugineum Thhalv10008858m.g I 0.594
Bra018624 Brassica rapa Bra018624 I 0.594
Bra031629 Brassica rapa Bra031629 I 0.594
Bra030728 Brassica rapa Bra030728 I 0.594
Bra000378 Brassica rapa Bra000378 I 0.594
Bo9g001130 Brassica oleracea Bo9g001130 I 0.594
Bo6g073320 Brassica oleracea Bo6g073320 I 0.594
Bo5g009010 Brassica oleracea Bo5g009010 I 0.594
Thhalv10017320m.g Eutrema salsugineum Thhalv10017320m.g I 0.594
Bo8g055830 Brassica oleracea Bo8g055830 I 0.594
Bo8g112450 Brassica oleracea Bo8g112450 I 0.594
orange1.1g028980m.g Citrus sinensis orange1.1g028980m.g I 0.594
Pavir.Ca02862 Panicum virgatum Pavir.Ca02862 I 0.594
Gorai.001G127000 Gossypium raimondii Gorai.001G127000 I 0.594
MDP0000255415 Malus domestica MDP0000255415 I 0.594
LPERR03G22960 Leersia perrieri LPERR03G22960 I 0.594
Gorai.001G042700 Gossypium raimondii Gorai.001G042700 I 0.594
29854.m001136 Ricinus communis 29854.m001136 I 0.594
OB12G26050 Oryza brachyantha OB12G26050 I 0.594
LPERR07G03250 Leersia perrieri LPERR07G03250 I 0.594
OBART03G27740 Oryza barthii OBART03G27740 I 0.594
GSMUA_Achr7G01330_001 Musa acuminata GSMUA_Achr7G01330_001 I 0.594
Lus10036811.g Linum usitatissimum Lus10036811.g I 0.594
GSMUA_Achr8G04750_001 Musa acuminata GSMUA_Achr8G04750_001 I 0.594
OB07G12810 Oryza brachyantha OB07G12810 I 0.594
Gorai.006G117800 Gossypium raimondii Gorai.006G117800 I 0.594
OB03G35470 Oryza brachyantha OB03G35470 I 0.594
MDP0000252640 Malus domestica MDP0000252640 I 0.594
Lus10019407.g Linum usitatissimum Lus10019407.g I 0.594
MLOC_70676 Hordeum vulgare MLOC_70676 I 0.594
GSMUA_Achr2G12850_001 Musa acuminata GSMUA_Achr2G12850_001 I 0.594
GSMUA_Achr3G15060_001 Musa acuminata GSMUA_Achr3G15060_001 I 0.594
MTR_4g050300 Medicago truncatula MTR_4g050300 I 0.594
Gorai.009G016700 Gossypium raimondii Gorai.009G016700 I 0.594
MTR_4g114730 Medicago truncatula MTR_4g114730 I 0.594
MDP0000500810 Malus domestica MDP0000500810 I 0.594
Gorai.010G062900 Gossypium raimondii Gorai.010G062900 I 0.594
GSMUA_Achr8G26600_001 Musa acuminata GSMUA_Achr8G26600_001 I 0.594
GSMUA_Achr4G22750_001 Musa acuminata GSMUA_Achr4G22750_001 I 0.594
gene31056-v1.0-hybrid Fragaria vesca gene31056-v1.0-hybrid I 0.594
MDP0000331808 Malus domestica MDP0000331808 I 0.594
MTR_2g087740 Medicago truncatula MTR_2g087740 I 0.594
OGLUM03G28370 Oryza glumaepatula OGLUM03G28370 I 0.594
MDP0000366291 Malus domestica MDP0000366291 I 0.594
Gorai.005G146700 Gossypium raimondii Gorai.005G146700 I 0.594
LPERR07G16630 Leersia perrieri LPERR07G16630 I 0.593
evm.TU.supercontig_69.72 Carica papaya evm.TU.supercontig_69.72 I 0.589
TCM_031868 Theobroma cacao TCM_031868 I 0.588
Gorai.002G054200 Gossypium raimondii Gorai.002G054200 I 0.588
Gorai.009G367100 Gossypium raimondii Gorai.009G367100 I 0.588
POPTR_0010s16410 Populus trichocarpa POPTR_0010s16410 I 0.588
SapurV1A.0072s0330 Salix purpurea SapurV1A.0072s0330 I 0.588
GSMUA_Achr7G07830_001 Musa acuminata GSMUA_Achr7G07830_001 I 0.584
VIT_08s0032g01110 Vitis vinifera VIT_08s0032g01110 I 0.584
GSMUA_Achr4G31310_001 Musa acuminata GSMUA_Achr4G31310_001 I 0.584
GSMUA_Achr6G31080_001 Musa acuminata GSMUA_Achr6G31080_001 I 0.584
GSMUA_Achr3G25660_001 Musa acuminata GSMUA_Achr3G25660_001 I 0.572
MDP0000171878 Malus domestica MDP0000171878 I 0.571
MDP0000126221 Malus domestica MDP0000126221 I 0.570
POPTR_0008s09740 Populus trichocarpa POPTR_0008s09740 I 0.567
Eucgr.B03310 Eucalyptus grandis Eucgr.B03310 I 0.566
LjSGA_107961.1 Lotus japonicus LjSGA_107961.1 I 0.565
Gorai.008G236500 Gossypium raimondii Gorai.008G236500 I 0.565
30174.m008839 Ricinus communis 30174.m008839 I 0.565
cassava13963.valid.m1 Manihot esculenta cassava13963.valid.m1 I 0.565
evm.TU.supercontig_29.121 Carica papaya evm.TU.supercontig_29.121 I 0.565
cassava17722.valid.m1 Manihot esculenta cassava17722.valid.m1 I 0.565
Thhalv10019126m.g Eutrema salsugineum Thhalv10019126m.g I 0.565
Gorai.001G174800 Gossypium raimondii Gorai.001G174800 I 0.565
Eucgr.E01474 Eucalyptus grandis Eucgr.E01474 I 0.565
gene32251-v1.0-hybrid Fragaria vesca gene32251-v1.0-hybrid I 0.565
evm.TU.supercontig_145.3 Carica papaya evm.TU.supercontig_145.3 I 0.565
cassava43469.valid.m1 Manihot esculenta cassava43469.valid.m1 I 0.565
MDP0000298333 Malus domestica MDP0000298333 I 0.565
Pavir.Gb00743 Panicum virgatum Pavir.Gb00743 I 0.565
Cagra.0537s0004 Capsella grandiflora Cagra.0537s0004 I 0.565
MDP0000291729 Malus domestica MDP0000291729 I 0.565
Pavir.Ib03707 Panicum virgatum Pavir.Ib03707 I 0.565
mgf003166m Mimulus guttatus mgf003166m I 0.565
mgf011463m Mimulus guttatus mgf011463m I 0.565
Pavir.Ga00891 Panicum virgatum Pavir.Ga00891 I 0.565
Bostr.10273s0455 Boechera stricta Bostr.10273s0455 I 0.565
orange1.1g028144m.g Citrus sinensis orange1.1g028144m.g I 0.565
Pavir.Aa01223 Panicum virgatum Pavir.Aa01223 I 0.565
Pavir.Ab02534 Panicum virgatum Pavir.Ab02534 I 0.565
mgf015806m Mimulus guttatus mgf015806m I 0.565
SapurV1A.0033s0530 Salix purpurea SapurV1A.0033s0530 I 0.565
MDP0000192940 Malus domestica MDP0000192940 I 0.565
SapurV1A.2672s0010 Salix purpurea SapurV1A.2672s0010 I 0.565
SapurV1A.1275s0050 Salix purpurea SapurV1A.1275s0050 I 0.565
Carubv10021641m.g Capsella rubella Carubv10021641m.g I 0.565
Lus10010361.g Linum usitatissimum Lus10010361.g I 0.565
cassava30083.valid.m1 Manihot esculenta cassava30083.valid.m1 I 0.565
Ciclev10021834m.g Citrus clementina Ciclev10021834m.g I 0.565
orange1.1g027215m.g Citrus sinensis orange1.1g027215m.g I 0.565
Lus10036496.g Linum usitatissimum Lus10036496.g I 0.565
SapurV1A.0217s0100 Salix purpurea SapurV1A.0217s0100 I 0.565
Cucsa.320600 Cucumis sativus Cucsa.320600 I 0.565
Cucsa.302100 Cucumis sativus Cucsa.302100 I 0.565
MDP0000124879 Malus domestica MDP0000124879 I 0.565
SapurV1A.0634s0130 Salix purpurea SapurV1A.0634s0130 I 0.565
Ciclev10022170m.g Citrus clementina Ciclev10022170m.g I 0.565
Si010859m.g Setaria italica Si010859m.g I 0.565
OGLUM02G26190 Oryza glumaepatula OGLUM02G26190 I 0.565
OBART10G15260 Oryza barthii OBART10G15260 I 0.565
OGLUM04G19890 Oryza glumaepatula OGLUM04G19890 I 0.565
OGLUM10G15140 Oryza glumaepatula OGLUM10G15140 I 0.565
OLONG_018621 Oryza longistaminata OLONG_018621 I 0.565
OBART02G25670 Oryza barthii OBART02G25670 I 0.565
OB04G27010 Oryza brachyantha OB04G27010 I 0.565
MLOC_70653 Hordeum vulgare MLOC_70653 I 0.565
MLOC_60897 Hordeum vulgare MLOC_60897 I 0.565
MTR_4g025900 Medicago truncatula MTR_4g025900 I 0.565
MTR_4g101660 Medicago truncatula MTR_4g101660 I 0.565
OB02G33040 Oryza brachyantha OB02G33040 I 0.565
OMERI02G25190 Oryza meridionalis OMERI02G25190 I 0.565
OMERI04G17000 Oryza meridionalis OMERI04G17000 I 0.565
ORGLA04G0171000 Oryza glaberrima ORGLA04G0171000 I 0.565
ORGLA02G0220100 Oryza glaberrima ORGLA02G0220100 I 0.565
ORUFI02G27080 Oryza rufipogon ORUFI02G27080 I 0.565
ORUFI04G21570 Oryza rufipogon ORUFI04G21570 I 0.565
ORUFI10G16240 Oryza rufipogon ORUFI10G16240 I 0.565
OPUNC10G13730 Oryza punctata OPUNC10G13730 I 0.565
OPUNC02G23520 Oryza punctata OPUNC02G23520 I 0.565
OMERI10G11950 Oryza meridionalis OMERI10G11950 I 0.565
ONIVA02G28110 Oryza nivara ONIVA02G28110 I 0.565
ONIVA04G18220 Oryza nivara ONIVA04G18220 I 0.565
ONIVA04G21490 Oryza nivara ONIVA04G21490 I 0.565
LPERR10G11580 Leersia perrieri LPERR10G11580 I 0.565
LPERR04G16190 Leersia perrieri LPERR04G16190 I 0.565
F775_25525 Aegilops tauschii F775_25525 I 0.565
BRADI5G16910 Brachypodium distachyon BRADI5G16910 I 0.565
F775_27799 Aegilops tauschii F775_27799 I 0.565
CRC Arabidopsis lyrata fgenesh2_kg.2__1172__AT1G69180.1 I 0.565
GLYMA01G33370 Glycine max GLYMA01G33370 I 0.565
BRADI3G50050 Brachypodium distachyon BRADI3G50050 I 0.565
BRADI3G30410 Brachypodium distachyon BRADI3G30410 I 0.565
CRC Arabidopsis thaliana AT1G69180 D 0.565
BGIOSGA014650 Oryza indica BGIOSGA014650 I 0.565
Bo6g108630 Brassica oleracea Bo6g108630 I 0.565
Bra004364 Brassica rapa Bra004364 I 0.565
GLYMA03G03500 Glycine max GLYMA03G03500 I 0.565
GLYMA05G04260 Glycine max GLYMA05G04260 I 0.565
GSMUA_Achr11G17520_001 Musa acuminata GSMUA_Achr11G17520_001 I 0.565
GSMUA_Achr11G03800_001 Musa acuminata GSMUA_Achr11G03800_001 I 0.565
GSMUA_Achr7G07130_001 Musa acuminata GSMUA_Achr7G07130_001 I 0.565
GSMUA_Achr8G11580_001 Musa acuminata GSMUA_Achr8G11580_001 I 0.565
LPERR02G20990 Leersia perrieri LPERR02G20990 I 0.565
GRMZM2G529859 Zea mays GRMZM2G529859 I 0.565
GRMZM2G167824 Zea mays GRMZM2G167824 I 0.565
GLYMA17G14710 Glycine max GLYMA17G14710 I 0.565
GRMZM2G005353 Zea mays GRMZM2G005353 I 0.565
GRMZM2G054795 Zea mays GRMZM2G054795 I 0.565
GRMZM2G074543 Zea mays GRMZM2G074543 I 0.565
YAB4 Oryza sativa OS02G0643200 I 0.565
OBART04G20010 Oryza barthii OBART04G20010 I 0.565
Si018146m.g Setaria italica Si018146m.g I 0.565
Traes_6BL_3F8DB6043 Triticum aestivum Traes_6BL_3F8DB6043 I 0.565
Solyc01g091010.2 Solanum lycopersicum Solyc01g091010.2 I 0.565
Ca_25981 Cicer arietinum Ca_25981 I 0.565
Cla011745 Citrullus lanatus Cla011745 I 0.565
Pm017846 Prunus mume Pm017846 I 0.565
Pm023555 Prunus mume Pm023555 I 0.565
Sb04g033590 Sorghum bicolor Sb04g033590 I 0.565
Sb06g023770 Sorghum bicolor Sb06g023770 I 0.565
VIT_15s0048g00550 Vitis vinifera VIT_15s0048g00550 I 0.565
VIT_02s0154g00070 Vitis vinifera VIT_02s0154g00070 I 0.565
TRIUR3_27479 Triticum urartu TRIUR3_27479 I 0.565
Traes_2BL_8BEA9CE1B Triticum aestivum Traes_2BL_8BEA9CE1B I 0.565
Traes_6DL_59DB06B9F Triticum aestivum Traes_6DL_59DB06B9F I 0.565
Traes_6AL_2983D4EB6 Triticum aestivum Traes_6AL_2983D4EB6 I 0.565
Traes_2AL_71DE02042 Triticum aestivum Traes_2AL_71DE02042 I 0.565
Traes_1DL_C5AF9D06A Triticum aestivum Traes_1DL_C5AF9D06A I 0.565
TCM_005549 Theobroma cacao TCM_005549 I 0.565
TRIUR3_29073 Triticum urartu TRIUR3_29073 I 0.565
TCM_016030 Theobroma cacao TCM_016030 I 0.565
Sb01g017560 Sorghum bicolor Sb01g017560 I 0.565
Si036788m.g Setaria italica Si036788m.g I 0.565
POPTR_0003s11230 Populus trichocarpa POPTR_0003s11230 I 0.565
PGSC0003DMG400025969 Solanum tuberosum PGSC0003DMG400025969 I 0.565
PRUPE_ppa010905mg Prunus persica PRUPE_ppa010905mg I 0.565
28200.m000191 Ricinus communis 28200.m000191 I 0.565
POPTR_0014s06210 Populus trichocarpa POPTR_0014s06210 I 0.565
POPTR_0002s14600 Populus trichocarpa POPTR_0002s14600 I 0.565
YAB3 Oryza sativa OS10G0508300 I 0.565
YAB5 Oryza sativa OS04G0536300 I 0.565
PRUPE_ppa011209mg Prunus persica PRUPE_ppa011209mg I 0.565
POPTR_0001s00240 Populus trichocarpa POPTR_0001s00240 I 0.565
MDP0000263713 Malus domestica MDP0000263713 I 0.564
Solyc05g005240.1 Solanum lycopersicum Solyc05g005240.1 I 0.563
AMTR_s00096p00054100 Amborella trichopoda AMTR_s00096p00054100 I 0.562
OS03G0215200 Oryza sativa OS03G0215200 I 0.561
GSMUA_Achr6G24550_001 Musa acuminata GSMUA_Achr6G24550_001 I 0.561
GSMUA_Achr8G04340_001 Musa acuminata GSMUA_Achr8G04340_001 I 0.561
PDK_20s1325902g001 Phoenix dactylifera PDK_20s1325902g001 I 0.561
GSMUA_Achr5G08930_001 Musa acuminata GSMUA_Achr5G08930_001 I 0.561
Cucsa.286190 Cucumis sativus Cucsa.286190 I 0.561
Pavir.Ib00755 Panicum virgatum Pavir.Ib00755 I 0.561
Traes_4AS_BE972A266 Triticum aestivum Traes_4AS_BE972A266 I 0.561
Pavir.Ia04690 Panicum virgatum Pavir.Ia04690 I 0.561
Traes_4BL_34FE2C7F2 Triticum aestivum Traes_4BL_34FE2C7F2 I 0.561
GRMZM2G088309 Zea mays GRMZM2G088309 I 0.561
GRMZM2G102218 Zea mays GRMZM2G102218 I 0.561
GSMUA_Achr3G25290_001 Musa acuminata GSMUA_Achr3G25290_001 I 0.561
ORGLA03G0081000 Oryza glaberrima ORGLA03G0081000 I 0.561
ORUFI03G08400 Oryza rufipogon ORUFI03G08400 I 0.561
Traes_4AS_BE972A2661 Triticum aestivum Traes_4AS_BE972A2661 I 0.561
GSMUA_Achr4G01430_001 Musa acuminata GSMUA_Achr4G01430_001 I 0.561
TRIUR3_31693 Triticum urartu TRIUR3_31693 I 0.561
SapurV1A.0176s0460 Salix purpurea SapurV1A.0176s0460 I 0.561
BGIOSGA012115 Oryza indica BGIOSGA012115 I 0.561
OB03G18700 Oryza brachyantha OB03G18700 I 0.561
OBART03G08320 Oryza barthii OBART03G08320 I 0.561
OGLUM03G08460 Oryza glumaepatula OGLUM03G08460 I 0.561
OMERI03G08070 Oryza meridionalis OMERI03G08070 I 0.561
Sb01g042850 Sorghum bicolor Sb01g042850 I 0.561
OLONG_009200 Oryza longistaminata OLONG_009200 I 0.561
Ciclev10033770m.g Citrus clementina Ciclev10033770m.g I 0.561
OPUNC03G08080 Oryza punctata OPUNC03G08080 I 0.561
LPERR03G07620 Leersia perrieri LPERR03G07620 I 0.561
ONIVA03G09180 Oryza nivara ONIVA03G09180 I 0.561
Cla010239 Citrullus lanatus Cla010239 I 0.561
Si037608m.g Setaria italica Si037608m.g I 0.561
BRADI1G69900 Brachypodium distachyon BRADI1G69900 I 0.561
OB07G25220 Oryza brachyantha OB07G25220 I 0.559
OMERI07G16070 Oryza meridionalis OMERI07G16070 I 0.559
OLONG_001420 Oryza longistaminata OLONG_001420 I 0.558
ORGLA07G0250200 Oryza glaberrima ORGLA07G0250200 I 0.558
BGIOSGA025976 Oryza indica BGIOSGA025976 I 0.558
GSMUA_Achr1G27150_001 Musa acuminata GSMUA_Achr1G27150_001 I 0.555
GSMUA_Achr1G24490_001 Musa acuminata GSMUA_Achr1G24490_001 I 0.555
GSMUA_Achr1G04480_001 Musa acuminata GSMUA_Achr1G04480_001 I 0.555
AZW_EuGene.0200010417 Micromonas sp RCC299 AZW_EuGene.0200010417 I 0.555
GSMUA_Achr5G23610_001 Musa acuminata GSMUA_Achr5G23610_001 I 0.552
Pavir.Ba00601 Panicum virgatum Pavir.Ba00601 I 0.552
Pavir.Bb03145 Panicum virgatum Pavir.Bb03145 I 0.552
GRMZM2G046829 Zea mays GRMZM2G046829 I 0.546
SPPG_09438 Spizellomyces punctatus SPPG_09438 I 0.545
mgf023167m Mimulus guttatus mgf023167m I 0.538
29631.m001046 Ricinus communis 29631.m001046 I 0.534
EuGene.0000040541 Micromonas pusilla EuGene.0000040541 I 0.531
GUITHDRAFT_163519 Guillardia theta GUITHDRAFT_163519 I 0.520
PDK_20s1781371g001 Phoenix dactylifera PDK_20s1781371g001 I 0.517
GLOINDRAFT_342259 Rhizophagus irregularis GLOINDRAFT_342259 I 0.516
Lus10030596.g Linum usitatissimum Lus10030596.g I 0.512
Aquca_006_00412 Aquilegia coerulea Aquca_006_00412 I 0.510
Gorai.007G089700 Gossypium raimondii Gorai.007G089700 I 0.506
GUITHDRAFT_146350 Guillardia theta GUITHDRAFT_146350 I 0.499
EMIHUDRAFT_114782 Emiliania huxleyi EMIHUDRAFT_114782 I 0.489
EMIHUDRAFT_98817 Emiliania huxleyi EMIHUDRAFT_98817 I 0.489
BATDEDRAFT_7789 Batrachochytrium dendrobatidis BATDEDRAFT_7789 I 0.486
SPPG_01639 Spizellomyces punctatus SPPG_01639 I 0.483
GLOINDRAFT_347422 Rhizophagus irregularis GLOINDRAFT_347422 I 0.482
AMAG_02504 Allomyces macrogynus AMAG_02504 I 0.472
H101_08199 Trichophyton interdigitale H101_08199 N 0.467
23225_YPR052C Saccharomyces paradoxus 23225_YPR052C I 0.467
PEQ_0000212901 Parascaris equorum PEQ_0000212901 N 0.466
GLYMA03G08270 Glycine max GLYMA03G08270 I 0.463
GLOINDRAFT_337448 Rhizophagus irregularis GLOINDRAFT_337448 I 0.447
M407DRAFT_126438 Tulasnella calospora M407DRAFT_126438 I 0.443
EMIHUDRAFT_205413 Emiliania huxleyi EMIHUDRAFT_205413 I 0.442
Moror_16065 Moniliophthora roreri Moror_16065 I 0.440
DACRYDRAFT_54873 Dacryopinax sp DACRYDRAFT_54873 I 0.437
e_gw1.88.21.1 Fragilariopsis cylindrus e_gw1.88.21.1 N 0.436
CND03770 Cryptococcus neoformans CND03770 I 0.436
0600010013 Ostreococcus tauri 0600010013 I 0.433
UM06001 Ustilago maydis UM06001 I 0.433
PLICRDRAFT_179042 Plicaturopsis crispa PLICRDRAFT_179042 I 0.432
PPA10381 Pristionchus pacificus PPA10381 N 0.421
orange1.1g029982m.g Citrus sinensis orange1.1g029982m.g I 0.421
XM_002306945.1 Populus trichocarpa POPTR_0005s27390 I 0.415