GLYMA04G10125 (Glycine max)
Sox

TF Information

Pfam ID Interpro ID Gene ID CIS-BP ID Sequence source Animal TF db
PF00505 (HMG_box) IPR000910 GLYMA04G10125 T330267_2.00 Ensembl (2018-Dec-8) Link out

Directly determined binding motifs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
No direct experiments

Motifs from related TFs

Name/Motif ID Species Forward Reverse Type/Study/Study ID SR
Score
DBD
Identity
INO
M02485_2.00
Arabidopsis thaliana
NHNNNYRNNN

NNNYRNNNDN
PBM
Weirauch et al.(2014)
pTH7516
0.652 0.783
YAB5
M02486_2.00
Arabidopsis thaliana
NNNNHRN

NYDNNNN
PBM
Weirauch et al.(2014)
pTH7575
0.555 0.763
YAB5
M00889_2.00
Arabidopsis thaliana
NATRATTADNNN

NNNHTAATYATN
PBM
Franco-Zorrilla et al.(2014)
YAB5
0.555 0.763
YAB1
M00890_2.00
Arabidopsis thaliana
AATAATWA

TWATTATT
PBM
Franco-Zorrilla et al.(2014)
YAB1
0.555 0.737
CRC
M07266_2.00
Arabidopsis thaliana
TWATCATW

WATGATWA
Dap-seq
OMalley et al.(2016)
CRC_col_a
0.555 0.605
CRC
M07267_2.00
Arabidopsis thaliana
GGTTAGTGTTTTGGAGTCGAATATGACTTG

CAAGTCATATTCGACTCCAAAACACTAACC
Dap-seq
OMalley et al.(2016)
CRC_colamp_a
0.555 0.605
For this family, TFs with SR scores > 0.415 will likely have a similar motif

DNA Binding Domains

Protein ID Domain From To Sequence
GLYMA04G10125.1 Sox 120 165
GLYMA04G10125.2 Sox 119 164
GLYMA04G10125.3 Sox 120 157

Links

Other Sox family TFs
Other Glycine max TFs

540 Related TFs

Name Species Gene ID Motif Evidence SR
Score
Action
Lus10013028.g Linum usitatissimum Lus10013028.g I 0.706
Lus10029135.g Linum usitatissimum Lus10029135.g I 0.706
GLYMA01G03580 Glycine max GLYMA01G03580 I 0.702
POPTR_0010s05220 Populus trichocarpa POPTR_0010s05220 I 0.700
SapurV1A.0269s0230 Salix purpurea SapurV1A.0269s0230 I 0.700
SapurV1A.0069s0070 Salix purpurea SapurV1A.0069s0070 I 0.700
Carubv10012024m.g Capsella rubella Carubv10012024m.g I 0.696
Cagra.0605s0067 Capsella grandiflora Cagra.0605s0067 I 0.696
GLYMA08G39290 Glycine max GLYMA08G39290 I 0.683
GLYMA18G19720 Glycine max GLYMA18G19720 I 0.683
Ciclev10033714m.g Citrus clementina Ciclev10033714m.g I 0.670
POPTR_0008s19330 Populus trichocarpa POPTR_0008s19330 I 0.660
Bo7g056180 Brassica oleracea Bo7g056180 I 0.652
Bra024599 Brassica rapa Bra024599 I 0.652
Bra012373 Brassica rapa Bra012373 I 0.652
Bostr.12659s0203 Boechera stricta Bostr.12659s0203 I 0.652
INO Arabidopsis thaliana AT1G23420 D 0.652
Bo5g039580 Brassica oleracea Bo5g039580 I 0.652
INO Arabidopsis lyrata fgenesh1_pg.C_scaffold_1002152 I 0.652
Thhalv10008669m.g Eutrema salsugineum Thhalv10008669m.g I 0.652
chr2.CM0008.270.nc Lotus japonicus chr2.CM0008.270.nc I 0.645
GLYMA06G10110 Glycine max GLYMA06G10110 I 0.640
Ca_21472 Cicer arietinum Ca_21472 I 0.640
MTR_5g034030 Medicago truncatula MTR_5g034030 I 0.640
Pm006709 Prunus mume Pm006709 I 0.636
PRUPE_ppa023883mg Prunus persica PRUPE_ppa023883mg I 0.636
INO Vitis vinifera VIT_01s0127g00330 I 0.636
orange1.1g037247m.g Citrus sinensis orange1.1g037247m.g I 0.633
cassava41595.m1 Manihot esculenta cassava41595.m1 I 0.633
Cla000824 Citrullus lanatus Cla000824 I 0.632
Cucsa.394330 Cucumis sativus Cucsa.394330 I 0.632
cassava26804.m1 Manihot esculenta cassava26804.m1 I 0.632
GSMUA_Achr8G26600_001 Musa acuminata GSMUA_Achr8G26600_001 I 0.631
GSMUA_Achr8G04750_001 Musa acuminata GSMUA_Achr8G04750_001 I 0.631
GSMUA_Achr3G15060_001 Musa acuminata GSMUA_Achr3G15060_001 I 0.631
LPERR07G16630 Leersia perrieri LPERR07G16630 I 0.630
cassava27370.m1 Manihot esculenta cassava27370.m1 I 0.626
BRADI1G57070 Brachypodium distachyon BRADI1G57070 I 0.622
GSMUA_AchrUn_randomG19410_001 Musa acuminata GSMUA_AchrUn_randomG19410_001 I 0.622
GSMUA_Achr6G31080_001 Musa acuminata GSMUA_Achr6G31080_001 I 0.621
GSMUA_Achr4G31310_001 Musa acuminata GSMUA_Achr4G31310_001 I 0.621
VIT_08s0032g01110 Vitis vinifera VIT_08s0032g01110 I 0.621
GSMUA_Achr7G07830_001 Musa acuminata GSMUA_Achr7G07830_001 I 0.621
Cla010239 Citrullus lanatus Cla010239 I 0.617
evm.TU.supercontig_69.72 Carica papaya evm.TU.supercontig_69.72 I 0.617
SapurV1A.0258s0090 Salix purpurea SapurV1A.0258s0090 I 0.617
POPTR_0016s06760 Populus trichocarpa POPTR_0016s06760 I 0.617
SapurV1A.0248s0170 Salix purpurea SapurV1A.0248s0170 I 0.616
GSMUA_Achr3G30800_001 Musa acuminata GSMUA_Achr3G30800_001 I 0.616
Lus10024603.g Linum usitatissimum Lus10024603.g I 0.616
Lus10032240.g Linum usitatissimum Lus10032240.g I 0.616
Traes_5DL_0E369E1FC Triticum aestivum Traes_5DL_0E369E1FC I 0.611
ORUFI10G16240 Oryza rufipogon ORUFI10G16240 I 0.611
orange1.1g028144m.g Citrus sinensis orange1.1g028144m.g I 0.611
TCM_005549 Theobroma cacao TCM_005549 I 0.611
TCM_016030 Theobroma cacao TCM_016030 I 0.611
Traes_5BS_A782F7510 Triticum aestivum Traes_5BS_A782F7510 I 0.611
Traes_5DS_268147383 Triticum aestivum Traes_5DS_268147383 I 0.611
Solyc12g009580.1 Solanum lycopersicum Solyc12g009580.1 I 0.611
TRIUR3_18590 Triticum urartu TRIUR3_18590 I 0.611
ORUFI12G21410 Oryza rufipogon ORUFI12G21410 I 0.611
Traes_6DL_59DB06B9F Triticum aestivum Traes_6DL_59DB06B9F I 0.611
Traes_6BL_3F8DB6043 Triticum aestivum Traes_6BL_3F8DB6043 I 0.611
Traes_6AL_2983D4EB6 Triticum aestivum Traes_6AL_2983D4EB6 I 0.611
orange1.1g027215m.g Citrus sinensis orange1.1g027215m.g I 0.611
TCM_038105 Theobroma cacao TCM_038105 I 0.611
ORUFI02G27080 Oryza rufipogon ORUFI02G27080 I 0.611
Traes_2AL_71DE02042 Triticum aestivum Traes_2AL_71DE02042 I 0.611
Traes_5AS_31C2540C0 Triticum aestivum Traes_5AS_31C2540C0 I 0.611
Traes_5AL_EB97D69D7 Triticum aestivum Traes_5AL_EB97D69D7 I 0.611
Traes_3AL_730255B9F Triticum aestivum Traes_3AL_730255B9F I 0.611
Traes_2BL_8BEA9CE1B Triticum aestivum Traes_2BL_8BEA9CE1B I 0.611
Traes_1DL_C5AF9D06A Triticum aestivum Traes_1DL_C5AF9D06A I 0.611
ORUFI03G28820 Oryza rufipogon ORUFI03G28820 I 0.611
Traes_5BL_4DEC298F9 Triticum aestivum Traes_5BL_4DEC298F9 I 0.611
ORUFI07G03450 Oryza rufipogon ORUFI07G03450 I 0.611
TCM_041175 Theobroma cacao TCM_041175 I 0.611
ORUFI04G21570 Oryza rufipogon ORUFI04G21570 I 0.611
MDP0000500810 Malus domestica MDP0000500810 I 0.611
Solyc11g071810.1 Solanum lycopersicum Solyc11g071810.1 I 0.611
Solyc01g091010.2 Solanum lycopersicum Solyc01g091010.2 I 0.611
POPTR_0018s12990 Populus trichocarpa POPTR_0018s12990 I 0.611
POPTR_0014s06210 Populus trichocarpa POPTR_0014s06210 I 0.611
Pavir.Cb00070 Panicum virgatum Pavir.Cb00070 I 0.611
Pavir.Ca02862 Panicum virgatum Pavir.Ca02862 I 0.611
Pavir.Ga00891 Panicum virgatum Pavir.Ga00891 I 0.611
PRUPE_ppa010905mg Prunus persica PRUPE_ppa010905mg I 0.611
YAB6 Oryza sativa OS12G0621100 I 0.611
PRUPE_ppa012028mg Prunus persica PRUPE_ppa012028mg I 0.611
PRUPE_ppa011880m2g Prunus persica PRUPE_ppa011880m2g I 0.611
PRUPE_ppa011209mg Prunus persica PRUPE_ppa011209mg I 0.611
PGSC0003DMG400002883 Solanum tuberosum PGSC0003DMG400002883 I 0.611
POPTR_0006s06700 Populus trichocarpa POPTR_0006s06700 I 0.611
Pavir.Ba03779 Panicum virgatum Pavir.Ba03779 I 0.611
PGSC0003DMG400004741 Solanum tuberosum PGSC0003DMG400004741 I 0.611
PGSC0003DMG400030904 Solanum tuberosum PGSC0003DMG400030904 I 0.611
PGSC0003DMG400025969 Solanum tuberosum PGSC0003DMG400025969 I 0.611
Pavir.Ab02534 Panicum virgatum Pavir.Ab02534 I 0.611
POPTR_0001s00240 Populus trichocarpa POPTR_0001s00240 I 0.611
PGSC0003DMG400002988 Solanum tuberosum PGSC0003DMG400002988 I 0.611
POPTR_0003s11230 Populus trichocarpa POPTR_0003s11230 I 0.611
POPTR_0002s14600 Populus trichocarpa POPTR_0002s14600 I 0.611
YAB2 Populus trichocarpa POPTR_0001s22180 I 0.611
Pavir.Aa01223 Panicum virgatum Pavir.Aa01223 I 0.611
orange1.1g046045m.g Citrus sinensis orange1.1g046045m.g I 0.611
Si030811m.g Setaria italica Si030811m.g I 0.611
Si023308m.g Setaria italica Si023308m.g I 0.611
Si018146m.g Setaria italica Si018146m.g I 0.611
Si010859m.g Setaria italica Si010859m.g I 0.611
Si036788m.g Setaria italica Si036788m.g I 0.611
Si037789m.g Setaria italica Si037789m.g I 0.611
Solyc07g008180.2 Solanum lycopersicum Solyc07g008180.2 I 0.611
Solyc06g073920.2 Solanum lycopersicum Solyc06g073920.2 I 0.611
PGSC0003DMG400005936 Solanum tuberosum PGSC0003DMG400005936 I 0.611
YAB4 Oryza sativa OS02G0643200 I 0.611
orange1.1g028980m.g Citrus sinensis orange1.1g028980m.g I 0.611
YAB2 Oryza sativa OS03G0650000 I 0.611
YAB1 Oryza sativa OS07G0160100 I 0.611
Sb01g013270 Sorghum bicolor Sb01g013270 I 0.611
orange1.1g029862m.g Citrus sinensis orange1.1g029862m.g I 0.611
YAB3 Oryza sativa OS10G0508300 I 0.611
Sb01g017560 Sorghum bicolor Sb01g017560 I 0.611
Sb02g003390 Sorghum bicolor Sb02g003390 I 0.611
AFO Arabidopsis lyrata scaffold_403460.1 I 0.611
Sb08g022030 Sorghum bicolor Sb08g022030 I 0.611
Sb06g023770 Sorghum bicolor Sb06g023770 I 0.611
Sb04g033590 Sorghum bicolor Sb04g033590 I 0.611
Solyc08g079100.2 Solanum lycopersicum Solyc08g079100.2 I 0.611
Cla005767 Citrullus lanatus Cla005767 I 0.611
Ciclev10009560m.g Citrus clementina Ciclev10009560m.g I 0.611
Carubv10024208m.g Capsella rubella Carubv10024208m.g I 0.611
Carubv10024011m.g Capsella rubella Carubv10024011m.g I 0.611
Carubv10010384m.g Capsella rubella Carubv10010384m.g I 0.611
Ciclev10021834m.g Citrus clementina Ciclev10021834m.g I 0.611
Ciclev10022170m.g Citrus clementina Ciclev10022170m.g I 0.611
Eucgr.D02474 Eucalyptus grandis Eucgr.D02474 I 0.611
Eucgr.C01515 Eucalyptus grandis Eucgr.C01515 I 0.611
MDP0000255415 Malus domestica MDP0000255415 I 0.611
Ciclev10029354m.g Citrus clementina Ciclev10029354m.g I 0.611
Carubv10001833m.g Capsella rubella Carubv10001833m.g I 0.611
Cagra.4395s0036 Capsella grandiflora Cagra.4395s0036 I 0.611
Bostr.22545s0001 Boechera stricta Bostr.22545s0001 I 0.611
Bostr.14547s0027 Boechera stricta Bostr.14547s0027 I 0.611
Aquca_020_00105 Aquilegia coerulea Aquca_020_00105 I 0.611
Aquca_009_00652 Aquilegia coerulea Aquca_009_00652 I 0.611
Bostr.25219s0098 Boechera stricta Bostr.25219s0098 I 0.611
Bostr.25993s0255 Boechera stricta Bostr.25993s0255 I 0.611
Cagra.1261s0010 Capsella grandiflora Cagra.1261s0010 I 0.611
Cagra.11302s0003 Capsella grandiflora Cagra.11302s0003 I 0.611
Cagra.0239s0072 Capsella grandiflora Cagra.0239s0072 I 0.611
Eucgr.E01474 Eucalyptus grandis Eucgr.E01474 I 0.611
Eucgr.J00587 Eucalyptus grandis Eucgr.J00587 I 0.611
MDP0000192940 Malus domestica MDP0000192940 I 0.611
Gorai.006G117800 Gossypium raimondii Gorai.006G117800 I 0.611
Gorai.001G174800 Gossypium raimondii Gorai.001G174800 I 0.611
Gorai.001G127000 Gossypium raimondii Gorai.001G127000 I 0.611
Gorai.008G236500 Gossypium raimondii Gorai.008G236500 I 0.611
Gorai.009G016700 Gossypium raimondii Gorai.009G016700 I 0.611
Lus10036496.g Linum usitatissimum Lus10036496.g I 0.611
Lus10019407.g Linum usitatissimum Lus10019407.g I 0.611
Lus10010361.g Linum usitatissimum Lus10010361.g I 0.611
Gorai.010G062900 Gossypium raimondii Gorai.010G062900 I 0.611
Gorai.001G042700 Gossypium raimondii Gorai.001G042700 I 0.611
gene32251-v1.0-hybrid Fragaria vesca gene32251-v1.0-hybrid I 0.611
evm.TU.supercontig_145.3 Carica papaya evm.TU.supercontig_145.3 I 0.611
evm.TU.supercontig_104.5 Carica papaya evm.TU.supercontig_104.5 I 0.611
evm.TU.supercontig_103.34 Carica papaya evm.TU.supercontig_103.34 I 0.611
MDP0000252640 Malus domestica MDP0000252640 I 0.611
evm.TU.supercontig_29.121 Carica papaya evm.TU.supercontig_29.121 I 0.611
evm.TU.supercontig_46.14 Carica papaya evm.TU.supercontig_46.14 I 0.611
gene31056-v1.0-hybrid Fragaria vesca gene31056-v1.0-hybrid I 0.611
gene04566-v1.0-hybrid Fragaria vesca gene04566-v1.0-hybrid I 0.611
gene03938-v1.0-hybrid Fragaria vesca gene03938-v1.0-hybrid I 0.611
mgf019496m Mimulus guttatus mgf019496m I 0.611
mgf015972m Mimulus guttatus mgf015972m I 0.611
Cla011745 Citrullus lanatus Cla011745 I 0.611
Cla008752 Citrullus lanatus Cla008752 I 0.611
ORGLA12G0165000 Oryza glaberrima ORGLA12G0165000 I 0.611
MDP0000298333 Malus domestica MDP0000298333 I 0.611
Cla012424 Citrullus lanatus Cla012424 I 0.611
Cla016962 Citrullus lanatus Cla016962 I 0.611
Pm027559 Prunus mume Pm027559 I 0.611
Pm023555 Prunus mume Pm023555 I 0.611
Pm017846 Prunus mume Pm017846 I 0.611
Pm001547 Prunus mume Pm001547 I 0.611
Ca_25981 Cicer arietinum Ca_25981 I 0.611
Ca_07101 Cicer arietinum Ca_07101 I 0.611
MDP0000331808 Malus domestica MDP0000331808 I 0.611
MDP0000366291 Malus domestica MDP0000366291 I 0.611
TRIUR3_29073 Triticum urartu TRIUR3_29073 I 0.611
TRIUR3_27479 Triticum urartu TRIUR3_27479 I 0.611
VIT_02s0154g00070 Vitis vinifera VIT_02s0154g00070 I 0.611
YAB2 Vitis vinifera VIT_06s0009g00880 I 0.611
Ca_06681 Cicer arietinum Ca_06681 I 0.611
VIT_15s0048g00550 Vitis vinifera VIT_15s0048g00550 I 0.611
YAB5 Vitis vinifera VIT_11s0016g05590 I 0.611
28200.m000191 Ricinus communis 28200.m000191 I 0.611
29854.m001136 Ricinus communis 29854.m001136 I 0.611
Cucsa.302100 Cucumis sativus Cucsa.302100 I 0.611
Cucsa.295080 Cucumis sativus Cucsa.295080 I 0.611
Cucsa.132170 Cucumis sativus Cucsa.132170 I 0.611
Cucsa.086660 Cucumis sativus Cucsa.086660 I 0.611
Cucsa.320600 Cucumis sativus Cucsa.320600 I 0.611
mgf003166m Mimulus guttatus mgf003166m I 0.611
mgf015806m Mimulus guttatus mgf015806m I 0.611
mgf011463m Mimulus guttatus mgf011463m I 0.611
mgf010765m Mimulus guttatus mgf010765m I 0.611
mgf009982m Mimulus guttatus mgf009982m I 0.611
cassava43469.valid.m1 Manihot esculenta cassava43469.valid.m1 I 0.611
cassava40986.m1 Manihot esculenta cassava40986.m1 I 0.611
cassava13510.valid.m1 Manihot esculenta cassava13510.valid.m1 I 0.611
cassava13509.valid.m1 Manihot esculenta cassava13509.valid.m1 I 0.611
30174.m008839 Ricinus communis 30174.m008839 I 0.611
29927.m000626 Ricinus communis 29927.m000626 I 0.611
cassava13963.valid.m1 Manihot esculenta cassava13963.valid.m1 I 0.611
cassava17722.valid.m1 Manihot esculenta cassava17722.valid.m1 I 0.611
cassava39022.m1 Manihot esculenta cassava39022.m1 I 0.611
cassava33847.m1 Manihot esculenta cassava33847.m1 I 0.611
cassava30083.valid.m1 Manihot esculenta cassava30083.valid.m1 I 0.611
TRIUR3_27402 Triticum urartu TRIUR3_27402 I 0.611
YAB5 Oryza sativa OS04G0536300 I 0.611
GLYMA06G46560 Glycine max GLYMA06G46560 I 0.611
GLYMA05G04260 Glycine max GLYMA05G04260 I 0.611
GLYMA03G03500 Glycine max GLYMA03G03500 I 0.611
GLYMA01G33370 Glycine max GLYMA01G33370 I 0.611
GLYMA12G10210 Glycine max GLYMA12G10210 I 0.611
GLYMA12G31670 Glycine max GLYMA12G31670 I 0.611
GLYMA17G12200 Glycine max GLYMA17G12200 I 0.611
GLYMA13G38750 Glycine max GLYMA13G38750 I 0.611
GLYMA13G22620 Glycine max GLYMA13G22620 I 0.611
SapurV1A.0217s0100 Salix purpurea SapurV1A.0217s0100 I 0.611
SapurV1A.0288s0210 Salix purpurea SapurV1A.0288s0210 I 0.611
SapurV1A.1275s0050 Salix purpurea SapurV1A.1275s0050 I 0.611
SapurV1A.2672s0010 Salix purpurea SapurV1A.2672s0010 I 0.611
F775_28710 Aegilops tauschii F775_28710 I 0.611
SapurV1A.1100s0080 Salix purpurea SapurV1A.1100s0080 I 0.611
YAB2 Arabidopsis lyrata fgenesh2_kg.1__861__AT1G08465.1 I 0.611
SapurV1A.0634s0130 Salix purpurea SapurV1A.0634s0130 I 0.611
YAB3 Arabidopsis lyrata fgenesh2_kg.6__3684__AT4G00180.1 I 0.611
YAB5 Arabidopsis lyrata fgenesh2_kg.4__584__AT2G26580.2 I 0.611
GLYMA17G14710 Glycine max GLYMA17G14710 I 0.611
GRMZM2G005353 Zea mays GRMZM2G005353 I 0.611
GSMUA_Achr7G01330_001 Musa acuminata GSMUA_Achr7G01330_001 I 0.611
GSMUA_Achr4G22750_001 Musa acuminata GSMUA_Achr4G22750_001 I 0.611
GSMUA_Achr2G12850_001 Musa acuminata GSMUA_Achr2G12850_001 I 0.611
GSMUA_Achr7G07130_001 Musa acuminata GSMUA_Achr7G07130_001 I 0.611
GSMUA_Achr8G11580_001 Musa acuminata GSMUA_Achr8G11580_001 I 0.611
Pavir.Ib04136 Panicum virgatum Pavir.Ib04136 I 0.611
SapurV1A.0033s0530 Salix purpurea SapurV1A.0033s0530 I 0.611
SapurV1A.0034s0500 Salix purpurea SapurV1A.0034s0500 I 0.611
GSMUA_Achr11G17520_001 Musa acuminata GSMUA_Achr11G17520_001 I 0.611
GSMUA_Achr11G03800_001 Musa acuminata GSMUA_Achr11G03800_001 I 0.611
GRMZM2G085873 Zea mays GRMZM2G085873 I 0.611
GRMZM2G074543 Zea mays GRMZM2G074543 I 0.611
GRMZM2G054795 Zea mays GRMZM2G054795 I 0.611
GRMZM2G106204 Zea mays GRMZM2G106204 I 0.611
GRMZM2G116646 Zea mays GRMZM2G116646 I 0.611
GRMZM2G529859 Zea mays GRMZM2G529859 I 0.611
GRMZM2G167824 Zea mays GRMZM2G167824 I 0.611
GRMZM2G141955 Zea mays GRMZM2G141955 I 0.611
F775_27799 Aegilops tauschii F775_27799 I 0.611
F775_25525 Aegilops tauschii F775_25525 I 0.611
Bo5g009010 Brassica oleracea Bo5g009010 I 0.611
Bo4g195410 Brassica oleracea Bo4g195410 I 0.611
Bo3g041840 Brassica oleracea Bo3g041840 I 0.611
Bo3g037630 Brassica oleracea Bo3g037630 I 0.611
Bo6g073320 Brassica oleracea Bo6g073320 I 0.611
Bo8g055830 Brassica oleracea Bo8g055830 I 0.611
Bra000378 Brassica rapa Bra000378 I 0.611
Bo9g001130 Brassica oleracea Bo9g001130 I 0.611
Bo8g112450 Brassica oleracea Bo8g112450 I 0.611
BGIOSGA037817 Oryza indica BGIOSGA037817 I 0.611
BGIOSGA014650 Oryza indica BGIOSGA014650 I 0.611
AMTR_s00085p00032940 Amborella trichopoda AMTR_s00085p00032940 I 0.611
AMTR_s00078p00029420 Amborella trichopoda AMTR_s00078p00029420 I 0.611
AMTR_s00004p00165390 Amborella trichopoda AMTR_s00004p00165390 I 0.611
YAB2 Arabidopsis thaliana AT1G08465 I 0.611
YAB5 Arabidopsis thaliana AT2G26580 D 0.611
BGIOSGA013223 Oryza indica BGIOSGA013223 I 0.611
YAB3 Arabidopsis thaliana AT4G00180 I 0.611
YAB1 Arabidopsis thaliana AT2G45190 D 0.611
Bra000538 Brassica rapa Bra000538 I 0.611
Bra003309 Brassica rapa Bra003309 I 0.611
PK06964.1 Cannabis sativa PK06964.1 I 0.611
PK09461.1 Cannabis sativa PK09461.1 I 0.611
LjSGA_107961.1 Lotus japonicus LjSGA_107961.1 I 0.611
Thhalv10028925m.g Eutrema salsugineum Thhalv10028925m.g I 0.611
Thhalv10017320m.g Eutrema salsugineum Thhalv10017320m.g I 0.611
SapurV1A.3336s0010 Salix purpurea SapurV1A.3336s0010 I 0.611
Thhalv10001617m.g Eutrema salsugineum Thhalv10001617m.g I 0.611
Thhalv10008858m.g Eutrema salsugineum Thhalv10008858m.g I 0.611
BRADI5G16910 Brachypodium distachyon BRADI5G16910 I 0.611
BRADI4G01300 Brachypodium distachyon BRADI4G01300 I 0.611
Bra031629 Brassica rapa Bra031629 I 0.611
Bra030728 Brassica rapa Bra030728 I 0.611
Bra018624 Brassica rapa Bra018624 I 0.611
Bra037320 Brassica rapa Bra037320 I 0.611
Bra040322 Brassica rapa Bra040322 I 0.611
BRADI3G50050 Brachypodium distachyon BRADI3G50050 I 0.611
BRADI3G30410 Brachypodium distachyon BRADI3G30410 I 0.611
BRADI1G13570 Brachypodium distachyon BRADI1G13570 I 0.611
Pavir.Ib03707 Panicum virgatum Pavir.Ib03707 I 0.611
GRMZM2G074124 Zea mays GRMZM2G074124 I 0.611
MTR_4g101660 Medicago truncatula MTR_4g101660 I 0.611
MTR_4g050300 Medicago truncatula MTR_4g050300 I 0.611
MTR_4g025900 Medicago truncatula MTR_4g025900 I 0.611
MTR_4g114730 Medicago truncatula MTR_4g114730 I 0.611
Pavir.Ia01130 Panicum virgatum Pavir.Ia01130 I 0.611
OB02G33040 Oryza brachyantha OB02G33040 I 0.611
Pavir.Gb00743 Panicum virgatum Pavir.Gb00743 I 0.611
MTR_2g087740 Medicago truncatula MTR_2g087740 I 0.611
OMERI02G25190 Oryza meridionalis OMERI02G25190 I 0.611
OMERI12G13460 Oryza meridionalis OMERI12G13460 I 0.611
MLOC_70653 Hordeum vulgare MLOC_70653 I 0.611
OBART03G27740 Oryza barthii OBART03G27740 I 0.611
OMERI07G02330 Oryza meridionalis OMERI07G02330 I 0.611
OMERI04G17000 Oryza meridionalis OMERI04G17000 I 0.611
MLOC_70676 Hordeum vulgare MLOC_70676 I 0.611
OLONG_018621 Oryza longistaminata OLONG_018621 I 0.611
OLONG_018568 Oryza longistaminata OLONG_018568 I 0.611
OB12G26050 Oryza brachyantha OB12G26050 I 0.611
OGLUM02G26190 Oryza glumaepatula OGLUM02G26190 I 0.611
OBART12G19190 Oryza barthii OBART12G19190 I 0.611
OBART02G25670 Oryza barthii OBART02G25670 I 0.611
OBART04G20010 Oryza barthii OBART04G20010 I 0.611
OBART10G15260 Oryza barthii OBART10G15260 I 0.611
OB07G12810 Oryza brachyantha OB07G12810 I 0.611
LPERR02G20990 Leersia perrieri LPERR02G20990 I 0.611
OGLUM10G15140 Oryza glumaepatula OGLUM10G15140 I 0.611
OGLUM12G20870 Oryza glumaepatula OGLUM12G20870 I 0.611
OB03G35470 Oryza brachyantha OB03G35470 I 0.611
OB04G27010 Oryza brachyantha OB04G27010 I 0.611
OGLUM03G28370 Oryza glumaepatula OGLUM03G28370 I 0.611
OGLUM04G19890 Oryza glumaepatula OGLUM04G19890 I 0.611
MLOC_66260 Hordeum vulgare MLOC_66260 I 0.611
OMERI10G11950 Oryza meridionalis OMERI10G11950 I 0.611
LPERR10G11580 Leersia perrieri LPERR10G11580 I 0.611
ONIVA02G03100 Oryza nivara ONIVA02G03100 I 0.611
OPUNC07G03670 Oryza punctata OPUNC07G03670 I 0.611
OPUNC03G25290 Oryza punctata OPUNC03G25290 I 0.611
OPUNC02G23520 Oryza punctata OPUNC02G23520 I 0.611
OPUNC12G17340 Oryza punctata OPUNC12G17340 I 0.611
LPERR07G03250 Leersia perrieri LPERR07G03250 I 0.611
LPERR03G22960 Leersia perrieri LPERR03G22960 I 0.611
ORGLA04G0171000 Oryza glaberrima ORGLA04G0171000 I 0.611
ORGLA02G0220100 Oryza glaberrima ORGLA02G0220100 I 0.611
LPERR04G16190 Leersia perrieri LPERR04G16190 I 0.611
ONIVA04G21490 Oryza nivara ONIVA04G21490 I 0.611
OPUNC10G13730 Oryza punctata OPUNC10G13730 I 0.611
ONIVA02G28110 Oryza nivara ONIVA02G28110 I 0.611
ONIVA04G18220 Oryza nivara ONIVA04G18220 I 0.611
MLOC_60897 Hordeum vulgare MLOC_60897 I 0.611
ONIVA03G28660 Oryza nivara ONIVA03G28660 I 0.611
MDP0000171878 Malus domestica MDP0000171878 I 0.610
mgf007067m Mimulus guttatus mgf007067m I 0.610
AMTR_s00047p00199030 Amborella trichopoda AMTR_s00047p00199030 I 0.610
SPPG_09438 Spizellomyces punctatus SPPG_09438 I 0.608
Solyc05g012050.2 Solanum lycopersicum Solyc05g012050.2 I 0.608
PGSC0003DMG400028360 Solanum tuberosum PGSC0003DMG400028360 I 0.608
Gorai.009G367100 Gossypium raimondii Gorai.009G367100 I 0.605
Gorai.002G054200 Gossypium raimondii Gorai.002G054200 I 0.605
TCM_031868 Theobroma cacao TCM_031868 I 0.605
Lus10036811.g Linum usitatissimum Lus10036811.g I 0.604
Cucsa.284430 Cucumis sativus Cucsa.284430 I 0.604
MDP0000126221 Malus domestica MDP0000126221 I 0.604
Eucgr.B03140 Eucalyptus grandis Eucgr.B03140 I 0.604
MDP0000124879 Malus domestica MDP0000124879 I 0.604
Thhalv10019126m.g Eutrema salsugineum Thhalv10019126m.g I 0.604
Gorai.005G146700 Gossypium raimondii Gorai.005G146700 I 0.604
Bo6g108630 Brassica oleracea Bo6g108630 I 0.604
Carubv10021641m.g Capsella rubella Carubv10021641m.g I 0.604
Cagra.0537s0004 Capsella grandiflora Cagra.0537s0004 I 0.604
PK13838.1 Cannabis sativa PK13838.1 I 0.604
Bra004364 Brassica rapa Bra004364 I 0.604
Bostr.10273s0455 Boechera stricta Bostr.10273s0455 I 0.604
evm.TU.contig_30608 Carica papaya evm.TU.contig_30608 I 0.604
CRC Arabidopsis thaliana AT1G69180 D 0.604
MDP0000291729 Malus domestica MDP0000291729 I 0.604
30174.m009083 Ricinus communis 30174.m009083 I 0.604
cassava10710.m1 Manihot esculenta cassava10710.m1 I 0.604
GLYMA01G08030 Glycine max GLYMA01G08030 I 0.604
GLYMA02G13350 Glycine max GLYMA02G13350 I 0.604
PRUPE_ppa014900mg Prunus persica PRUPE_ppa014900mg I 0.604
Cla010397 Citrullus lanatus Cla010397 I 0.604
Pm030598 Prunus mume Pm030598 I 0.604
CRC Vitis vinifera VIT_01s0011g00140 I 0.604
Ca_18533 Cicer arietinum Ca_18533 I 0.604
TCM_011484 Theobroma cacao TCM_011484 I 0.604
cassava39135.m1 Manihot esculenta cassava39135.m1 I 0.604
CRC Arabidopsis lyrata fgenesh2_kg.2__1172__AT1G69180.1 I 0.604
Ca_12379 Cicer arietinum Ca_12379 I 0.604
mgf001016m Mimulus guttatus mgf001016m I 0.602
AMTR_s00096p00054100 Amborella trichopoda AMTR_s00096p00054100 I 0.599
MDP0000263713 Malus domestica MDP0000263713 I 0.598
Cucsa.286190 Cucumis sativus Cucsa.286190 I 0.598
POPTR_0010s16410 Populus trichocarpa POPTR_0010s16410 I 0.598
SapurV1A.0072s0330 Salix purpurea SapurV1A.0072s0330 I 0.598
Solyc05g005240.1 Solanum lycopersicum Solyc05g005240.1 I 0.597
Lus10030892.g Linum usitatissimum Lus10030892.g I 0.593
GSMUA_Achr5G23610_001 Musa acuminata GSMUA_Achr5G23610_001 I 0.589
GSMUA_Achr3G25660_001 Musa acuminata GSMUA_Achr3G25660_001 I 0.589
OMERI07G16070 Oryza meridionalis OMERI07G16070 I 0.587
OB07G25220 Oryza brachyantha OB07G25220 I 0.587
BGIOSGA025976 Oryza indica BGIOSGA025976 I 0.586
OLONG_001420 Oryza longistaminata OLONG_001420 I 0.586
ORGLA07G0250200 Oryza glaberrima ORGLA07G0250200 I 0.586
AZW_EuGene.0200010417 Micromonas sp RCC299 AZW_EuGene.0200010417 I 0.585
GRMZM2G046829 Zea mays GRMZM2G046829 I 0.580
POPTR_0008s09740 Populus trichocarpa POPTR_0008s09740 I 0.578
Eucgr.B03310 Eucalyptus grandis Eucgr.B03310 I 0.575
Pavir.Ba00601 Panicum virgatum Pavir.Ba00601 I 0.574
Pavir.Bb03145 Panicum virgatum Pavir.Bb03145 I 0.574
Pavir.Ib00755 Panicum virgatum Pavir.Ib00755 I 0.572
TRIUR3_31693 Triticum urartu TRIUR3_31693 I 0.572
OPUNC03G08080 Oryza punctata OPUNC03G08080 I 0.572
ONIVA03G09180 Oryza nivara ONIVA03G09180 I 0.572
Pavir.Ia04690 Panicum virgatum Pavir.Ia04690 I 0.572
GSMUA_Achr6G24550_001 Musa acuminata GSMUA_Achr6G24550_001 I 0.572
Traes_4BL_34FE2C7F2 Triticum aestivum Traes_4BL_34FE2C7F2 I 0.572
ORUFI03G08400 Oryza rufipogon ORUFI03G08400 I 0.572
Traes_4AS_BE972A266 Triticum aestivum Traes_4AS_BE972A266 I 0.572
Traes_4AS_BE972A2661 Triticum aestivum Traes_4AS_BE972A2661 I 0.572
LPERR03G07620 Leersia perrieri LPERR03G07620 I 0.572
ORGLA03G0081000 Oryza glaberrima ORGLA03G0081000 I 0.572
GSMUA_Achr8G04340_001 Musa acuminata GSMUA_Achr8G04340_001 I 0.572
GSMUA_Achr3G25290_001 Musa acuminata GSMUA_Achr3G25290_001 I 0.572
BGIOSGA012115 Oryza indica BGIOSGA012115 I 0.572
GSMUA_Achr4G01430_001 Musa acuminata GSMUA_Achr4G01430_001 I 0.572
GSMUA_Achr5G08930_001 Musa acuminata GSMUA_Achr5G08930_001 I 0.572
OS03G0215200 Oryza sativa OS03G0215200 I 0.572
GRMZM2G088309 Zea mays GRMZM2G088309 I 0.572
OLONG_009200 Oryza longistaminata OLONG_009200 I 0.572
OB03G18700 Oryza brachyantha OB03G18700 I 0.572
BRADI1G69900 Brachypodium distachyon BRADI1G69900 I 0.572
PDK_20s1325902g001 Phoenix dactylifera PDK_20s1325902g001 I 0.572
mgf023167m Mimulus guttatus mgf023167m I 0.572
OBART03G08320 Oryza barthii OBART03G08320 I 0.572
Sb01g042850 Sorghum bicolor Sb01g042850 I 0.572
OMERI03G08070 Oryza meridionalis OMERI03G08070 I 0.572
GLOINDRAFT_342259 Rhizophagus irregularis GLOINDRAFT_342259 I 0.572
Ciclev10033770m.g Citrus clementina Ciclev10033770m.g I 0.572
GRMZM2G102218 Zea mays GRMZM2G102218 I 0.572
SapurV1A.0176s0460 Salix purpurea SapurV1A.0176s0460 I 0.572
Si037608m.g Setaria italica Si037608m.g I 0.572
OGLUM03G08460 Oryza glumaepatula OGLUM03G08460 I 0.572
GSMUA_Achr1G24490_001 Musa acuminata GSMUA_Achr1G24490_001 I 0.565
GSMUA_Achr1G27150_001 Musa acuminata GSMUA_Achr1G27150_001 I 0.565
GSMUA_Achr1G04480_001 Musa acuminata GSMUA_Achr1G04480_001 I 0.565
chr2.CM0237.250.nd Lotus japonicus chr2.CM0237.250.nd I 0.562
PDK_20s1781371g001 Phoenix dactylifera PDK_20s1781371g001 I 0.551
GUITHDRAFT_163519 Guillardia theta GUITHDRAFT_163519 I 0.548
SPPG_01639 Spizellomyces punctatus SPPG_01639 I 0.540
EuGene.0000040541 Micromonas pusilla EuGene.0000040541 I 0.539
GLOINDRAFT_347422 Rhizophagus irregularis GLOINDRAFT_347422 I 0.538
GUITHDRAFT_146350 Guillardia theta GUITHDRAFT_146350 I 0.536
EMIHUDRAFT_98817 Emiliania huxleyi EMIHUDRAFT_98817 I 0.534
EMIHUDRAFT_114782 Emiliania huxleyi EMIHUDRAFT_114782 I 0.534
BATDEDRAFT_7789 Batrachochytrium dendrobatidis BATDEDRAFT_7789 I 0.529
Aquca_006_00412 Aquilegia coerulea Aquca_006_00412 I 0.520
AMAG_02504 Allomyces macrogynus AMAG_02504 I 0.519
29631.m001046 Ricinus communis 29631.m001046 I 0.515
Lus10030596.g Linum usitatissimum Lus10030596.g I 0.510
GLOINDRAFT_337448 Rhizophagus irregularis GLOINDRAFT_337448 I 0.504
Moror_16065 Moniliophthora roreri Moror_16065 I 0.504
M407DRAFT_126438 Tulasnella calospora M407DRAFT_126438 I 0.500
DACRYDRAFT_54873 Dacryopinax sp DACRYDRAFT_54873 I 0.494
CND03770 Cryptococcus neoformans CND03770 I 0.492
PSEUBRA_SCAF20g03069 Pseudozyma brasiliensis PSEUBRA_SCAF20g03069 I 0.489
BOTBODRAFT_39377 Botryobasidium botryosum BOTBODRAFT_39377 I 0.471
Gorai.007G089700 Gossypium raimondii Gorai.007G089700 I 0.468
K437DRAFT_256012 Tilletiaria anomala K437DRAFT_256012 I 0.466
GLOINDRAFT_334763 Rhizophagus irregularis GLOINDRAFT_334763 I 0.466
UM06001 Ustilago maydis UM06001 I 0.460
CapteG224864 Capitella teleta CapteG224864 I 0.460
PILCRDRAFT_822980 Piloderma croceum PILCRDRAFT_822980 I 0.459
HETIRDRAFT_308278 Heterobasidion irregulare HETIRDRAFT_308278 I 0.457
e_gw1.1.2342.1 Heterobasidion annosum e_gw1.1.2342.1 I 0.457
RTG_00107 Rhodotorula glutinis RTG_00107 I 0.455
E5Q_04236 Mixia osmundae E5Q_04236 I 0.454
PLICRDRAFT_179042 Plicaturopsis crispa PLICRDRAFT_179042 I 0.454
E5Q_04235 Mixia osmundae E5Q_04235 I 0.454
HelroG66455 Helobdella robusta HelroG66455 N 0.453
M422DRAFT_175451 Sphaerobolus stellatus M422DRAFT_175451 I 0.453
GLOTRDRAFT_11089 Gloeophyllum trabeum GLOTRDRAFT_11089 I 0.452
AMAG_00993 Allomyces macrogynus AMAG_00993 I 0.451
tetur18g00680 Tetranychus urticae tetur18g00680 I 0.449
PISMIDRAFT_671062 Pisolithus microcarpus PISMIDRAFT_671062 I 0.448
Cflo_06133--XP_394373.1_APIME Camponotus floridanus Cflo_06133--XP_394373.1_APIME I 0.445
H101_08199 Trichophyton interdigitale H101_08199 N 0.438
23225_YPR052C Saccharomyces paradoxus 23225_YPR052C I 0.438
PFL1_06190 Pseudozyma flocculosa PFL1_06190 I 0.437
0600010013 Ostreococcus tauri 0600010013 I 0.433
TCM_018380 Theobroma cacao TCM_018380 I 0.433
EMIHUDRAFT_205413 Emiliania huxleyi EMIHUDRAFT_205413 I 0.432
KGM_20190 Danaus plexippus KGM_20190 I 0.431
MCINX012524 Melitaea cinxia MCINX012524 I 0.431
NEMVEDRAFT_v1g201358 Nematostella vectensis NEMVEDRAFT_v1g201358 I 0.431
GPUH_0000676401 Gongylonema pulchrum GPUH_0000676401 N 0.428
NBR_0000605501 Nippostrongylus brasiliensis NBR_0000605501 N 0.428
TCLT_0001081001 Thelazia callipaeda TCLT_0001081001 N 0.428
ANCCEY_08672 Ancylostoma ceylanicum ANCCEY_08672 N 0.428
ANCCAN_29654 Ancylostoma caninum ANCCAN_29654 N 0.428
NV13812 Nasonia vitripennis NV13812 I 0.427
CY34DRAFT_417575 Suillus luteus CY34DRAFT_417575 I 0.427
UHOR_08529 Ustilago hordei UHOR_08529 I 0.426
PaG_05633 Pseudozyma aphidis PaG_05633 I 0.426
PAN0_018d5604 Pseudozyma antarctica PAN0_018d5604 I 0.426
GLOINDRAFT_338425 Rhizophagus irregularis GLOINDRAFT_338425 I 0.425
GLYMA03G08270 Glycine max GLYMA03G08270 I 0.424
Ocbimv22013575m.g Octopus bimaculoides Ocbimv22013575m.g I 0.424
CBN09380 Caenorhabditis brenneri CBN09380 N 0.423
CRE03905 Caenorhabditis remanei CRE03905 N 0.423
CJA05209 Caenorhabditis japonica CJA05209 N 0.423
sr16632 Sporisorium reilianum sr16632 I 0.422
CLEC000086 Cimex lectularius CLEC000086 N 0.421
estExt_fgenesh3_kg.C_170031 Heterobasidion annosum estExt_fgenesh3_kg.C_170031 I 0.421
HETIRDRAFT_439796 Heterobasidion irregulare HETIRDRAFT_439796 I 0.421
CMT447C Cyanidioschyzon merolae CMT447C I 0.421
EuGene.0000030607 Micromonas pusilla EuGene.0000030607 N 0.420
MDOA001488 Musca domestica MDOA001488 I 0.420
GK13574 Drosophila willistoni FBgn0215582 I 0.420
GH18160 Drosophila grimshawi FBgn0125628 I 0.420
GALMADRAFT_234655 Galerina marginata GALMADRAFT_234655 N 0.420
GE25578 Drosophila yakuba FBgn0242642 I 0.420
HHAL005242-PA Halyomorpha halys HHAL005242-PA I 0.420
ENSSHAG00000004107 Sarcophilus harrisii ENSSHAG00000004107 N 0.418
XP_002941963 Xenopus tropicalis XP_002941963 N 0.418
ENSMODG00000024829 Monodelphis domestica ENSMODG00000024829 N 0.418
CHD4 Ochotona princeps ENSOPRG00000003477 N 0.418
CHD4 Microcebus murinus ENSMICG00000006588 N 0.418
CHD4 Echinops telfairi ENSETEG00000005912 N 0.418
RHTO_01283 Rhodosporidium toruloides RHTO_01283 I 0.417
SERLA73DRAFT_131740 Serpula lacrymans SERLA73DRAFT_131740 I 0.416
GB50764 Apis mellifera GB50764 I 0.416
PISMIDRAFT_684224 Pisolithus microcarpus PISMIDRAFT_684224 I 0.416
RHTO_05868 Rhodosporidium toruloides RHTO_05868 I 0.415
EuGene.0300010215 Micromonas sp RCC299 EuGene.0300010215 I 0.415
est_cluster_kg.Chr_05__92__3202834:1 Micromonas sp RCC299 est_cluster_kg.Chr_05__92__3202834:1 I 0.415
GLYMA01G28820 Glycine max GLYMA01G28820 I 0.415